ID: 1023320679

View in Genome Browser
Species Human (GRCh38)
Location 7:38994438-38994460
Sequence CCTCATTTGCACCTTTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023320679_1023320688 30 Left 1023320679 7:38994438-38994460 CCAGGACAAAGGTGCAAATGAGG 0: 1
1: 0
2: 0
3: 18
4: 170
Right 1023320688 7:38994491-38994513 TTTGTTGAACCCAGGGCATGGGG No data
1023320679_1023320687 29 Left 1023320679 7:38994438-38994460 CCAGGACAAAGGTGCAAATGAGG 0: 1
1: 0
2: 0
3: 18
4: 170
Right 1023320687 7:38994490-38994512 GTTTGTTGAACCCAGGGCATGGG No data
1023320679_1023320683 22 Left 1023320679 7:38994438-38994460 CCAGGACAAAGGTGCAAATGAGG 0: 1
1: 0
2: 0
3: 18
4: 170
Right 1023320683 7:38994483-38994505 TCTGCCAGTTTGTTGAACCCAGG No data
1023320679_1023320686 28 Left 1023320679 7:38994438-38994460 CCAGGACAAAGGTGCAAATGAGG 0: 1
1: 0
2: 0
3: 18
4: 170
Right 1023320686 7:38994489-38994511 AGTTTGTTGAACCCAGGGCATGG 0: 1
1: 0
2: 0
3: 25
4: 295
1023320679_1023320684 23 Left 1023320679 7:38994438-38994460 CCAGGACAAAGGTGCAAATGAGG 0: 1
1: 0
2: 0
3: 18
4: 170
Right 1023320684 7:38994484-38994506 CTGCCAGTTTGTTGAACCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023320679 Original CRISPR CCTCATTTGCACCTTTGTCC TGG (reversed) Intronic
900202648 1:1418020-1418042 CTGCATTAGCACCTTTGTTCTGG - Intergenic
900394249 1:2446659-2446681 CCTCCTTTGTCCCTTTGTGCTGG - Intronic
900610203 1:3541527-3541549 CCTGATTTGGACCCTGGTCCTGG - Intronic
900909777 1:5586851-5586873 CCTCACCAGCACCTTGGTCCTGG - Intergenic
901201887 1:7471836-7471858 CCTCATGTGCCCCTTTCTCCTGG + Intronic
902395059 1:16128034-16128056 CCTCCTTTTCTCCTTTTTCCTGG - Intronic
903980404 1:27182598-27182620 CCTCATCTGCACTTCTGTCTGGG + Intergenic
904004192 1:27355172-27355194 ACACTTTTGAACCTTTGTCCTGG - Exonic
904743945 1:32699544-32699566 TCTCACTGGCACTTTTGTCCTGG + Intronic
909476115 1:76082510-76082532 CCTCATTTGAACCTTTTCCTAGG - Intronic
910229482 1:84971452-84971474 CCCCATTTGTAGGTTTGTCCTGG + Intronic
912392685 1:109315444-109315466 CCTTCTGTGCACCCTTGTCCTGG - Intronic
912719188 1:112005424-112005446 CCTCCTCTGCACCTTCTTCCTGG - Intergenic
913496648 1:119433759-119433781 CCTCCTCTGCACCATTGCCCAGG - Intergenic
915611043 1:156992982-156993004 CCTCATTTACACATTTGTGATGG - Intronic
915770795 1:158420713-158420735 CATCATTTCCACCATTGTCCTGG - Exonic
915774267 1:158465693-158465715 CATCATTTCCACCATTGTGCTGG + Exonic
916611157 1:166393061-166393083 CCTCACCTGCACCTATGTCTTGG - Intergenic
917321438 1:173786569-173786591 GATCATTTGCACCTTTTTCAAGG + Exonic
917756351 1:178103001-178103023 CTTCATTTGCAGGTTTGTTCTGG - Intronic
917771623 1:178285885-178285907 ACTAATTTGCACCTTGGTTCTGG - Intronic
923812179 1:237330895-237330917 CTCCATCTGCACCTTTGTGCTGG + Exonic
924735521 1:246752285-246752307 CCTCATCTGCACTTCTGTCTAGG - Intronic
1063765594 10:9136697-9136719 CCTCATTTACAACTTGGTCATGG - Intergenic
1067326957 10:45278415-45278437 CCTTATTTGCACATCTGTCTAGG - Intergenic
1070710088 10:78674896-78674918 CCAAATTTGCACCTGTGACCTGG - Intergenic
1072787727 10:98295568-98295590 CCTGATTTGCTTCTTGGTCCTGG + Intergenic
1074058475 10:109943456-109943478 CCACATCTGCTCCCTTGTCCAGG + Intronic
1075527903 10:123201716-123201738 CCTCATTTGCACCTTTGAATTGG - Intergenic
1079013397 11:16847922-16847944 CCTAAGTTGCACCCTTGTTCAGG - Intronic
1080634652 11:34113054-34113076 CCTCATTTTCACCTTTACTCAGG + Intronic
1083184013 11:61007256-61007278 CCTCACTTGCTCCTGTCTCCAGG - Intronic
1084297253 11:68220937-68220959 CCTCATCTGCACCTTAAACCTGG - Intergenic
1084389737 11:68867262-68867284 CCTGACTTGCAGCTGTGTCCAGG + Intergenic
1084486383 11:69450592-69450614 ACTCATTTGCAACTTCCTCCTGG + Intergenic
1089920638 11:122206475-122206497 CCTTTTTTGCAACTCTGTCCAGG - Intergenic
1090992931 11:131837229-131837251 CCGAATTTGCACCTTTGTCAGGG + Intronic
1091446050 12:544713-544735 TCCCATTTGCCTCTTTGTCCAGG - Intronic
1091831012 12:3551263-3551285 CCTCAGGTGCAGCTTTGACCAGG + Intronic
1092555923 12:9561478-9561500 CCTCATTTGTACTTTGGCCCCGG - Intergenic
1094516175 12:31129192-31129214 CCTCATTTGTACTTTGGCCCCGG + Intergenic
1095559180 12:43545225-43545247 CCTCTTATGCACCATTGTGCAGG - Intronic
1104002980 12:124872256-124872278 ACACACTTGCACCTTTGTCCTGG - Intronic
1104463526 12:128972735-128972757 CCTCAGCTGCACCTTTTACCAGG - Intronic
1105293805 13:19071435-19071457 CATCATTTGCTGCTTTGTACAGG + Intergenic
1106387456 13:29301922-29301944 GCTCATTTGCACCTTCTACCAGG - Intronic
1108569726 13:51737404-51737426 AATCATTTGCCCATTTGTCCAGG + Intronic
1109337598 13:61012303-61012325 GACCATTTGCACCATTGTCCTGG - Intergenic
1114032022 14:18586554-18586576 CCTGATTTACACCTGTGTACTGG + Intergenic
1114076803 14:19165584-19165606 CCTGATTTACACCTGTGTACTGG + Intergenic
1114085360 14:19233984-19234006 CCTGATTTACACCTGTGTACTGG - Intergenic
1114494469 14:23123181-23123203 CCACATTTGCCCATTTGACCAGG + Intergenic
1115711189 14:36052872-36052894 CATCATTGGCAACTTTTTCCTGG - Intergenic
1120888611 14:89471832-89471854 CGTCATTTGCACCTTTCCCTCGG + Intronic
1121634697 14:95446004-95446026 CCTGATTGGCATCTTTGGCCAGG - Exonic
1122692064 14:103536170-103536192 ACACATTTGCCCCTTTGTCCTGG - Exonic
1122810376 14:104284776-104284798 CCTCGTTTCCACCATTGTCACGG + Intergenic
1202896921 14_GL000194v1_random:15692-15714 CCTGATTTACACCTGTGTACTGG - Intergenic
1124379287 15:29151234-29151256 CATCATTTGACCCTTTGCCCAGG - Intronic
1126778651 15:52119906-52119928 CCTCCTTTGCACCCTTCTCTAGG - Exonic
1128725842 15:69988042-69988064 ACTCATATGCCCCTTTGGCCTGG - Intergenic
1134215115 16:12311356-12311378 CATTATTTGCACCCCTGTCCAGG + Intronic
1134434331 16:14241894-14241916 GCTACTTTGCAGCTTTGTCCAGG + Intronic
1136279805 16:29201615-29201637 CCCCATTTGCAGCTCTGCCCGGG - Intergenic
1138160513 16:54748877-54748899 CCTAACTTGCTGCTTTGTCCAGG - Intergenic
1140458079 16:75116135-75116157 CCTCACTTCCTCCTTTCTCCAGG + Intronic
1142084198 16:88167725-88167747 CCCCATTTGCAGCTCTGCCCGGG - Intergenic
1143641581 17:8201467-8201489 CCTCCTGTGCACCTTTGTGATGG - Intergenic
1144397211 17:14856280-14856302 CCACATCTGCAGCTTTGTACAGG + Intergenic
1146725837 17:35155142-35155164 CCTCATGGGCCCCTCTGTCCTGG - Intronic
1147621232 17:41868730-41868752 CCTCAATGGCATCTTTGTGCTGG - Exonic
1147767113 17:42844665-42844687 CCTCATTACCATCTTTGCCCTGG + Exonic
1148333577 17:46826449-46826471 CCTCTTATGCACCTTTGTCTTGG + Intronic
1151536875 17:74744168-74744190 TCTCATCTGTACCTTTGTTCTGG - Intronic
1151853963 17:76708884-76708906 CCTCACTGGCACCTATGTCATGG + Intronic
1154172726 18:12062993-12063015 CCTCATTTACTCCTTTGTCAGGG - Intergenic
1155756254 18:29500389-29500411 CCTCTTTTGCCTCTTTCTCCCGG - Intergenic
1156219020 18:35032638-35032660 CCTCAATTGCACCTGTGTGCTGG + Intronic
1159320782 18:66845262-66845284 CATCATTTGCAATATTGTCCTGG - Intergenic
1160328015 18:77968321-77968343 CCTCATTTCCTCCACTGTCCAGG - Intergenic
1161372505 19:3921052-3921074 CCTCATTTGCATCCTGGTCTAGG - Intronic
1163436403 19:17298301-17298323 CCTCATTCTCTCCTTTATCCAGG - Intronic
1163812066 19:19439364-19439386 CATCATTCACACCTTGGTCCAGG - Intronic
1164473547 19:28555346-28555368 CCTTATTTGCAGTTCTGTCCAGG - Intergenic
1164632876 19:29773205-29773227 GCTCTTTTGCACCATTGTCATGG + Intergenic
1166554659 19:43690201-43690223 CTTCATTTGCACGTGCGTCCTGG + Intergenic
1166893471 19:46008717-46008739 CCTCTTCTGTACCTTTGTGCTGG + Intronic
1166916461 19:46198928-46198950 CTTCACTTGCTCTTTTGTCCAGG - Intergenic
928138574 2:28707751-28707773 TCTCATTTGCACCAGTGCCCTGG + Intergenic
928535505 2:32236262-32236284 CTTCATTTCCATCTTTTTCCAGG + Exonic
929087039 2:38178576-38178598 CATCATTTTCTTCTTTGTCCGGG + Intergenic
932443183 2:71751172-71751194 CCTCATTTGCACTTTCTTCTGGG + Intergenic
937454787 2:122031875-122031897 CTTCCTTTGCCCCTTTGCCCAGG - Intergenic
937642831 2:124233157-124233179 CCTCAGTGGCAGCATTGTCCTGG + Intronic
939501493 2:142991141-142991163 CGTCTTTTGCACATTTGTTCAGG + Intronic
943029773 2:182671574-182671596 CATCATTTGCAGCTTTGCTCTGG + Intergenic
945031748 2:205671335-205671357 GCTCATTTGCAACATTGTCATGG - Intergenic
945252585 2:207777073-207777095 GCTCCTTAGCACCTTTTTCCTGG + Intergenic
945672326 2:212817052-212817074 CCTCATTCCTACCTTTTTCCAGG + Intergenic
947323645 2:228950762-228950784 ACTCATTTGCACCTTTGGCTTGG - Intronic
1173988619 20:47282391-47282413 CTCCATTTGCAGTTTTGTCCAGG - Intronic
1175004979 20:55672219-55672241 CTTCTTTTTCACCTTTGTTCAGG - Intergenic
1176193014 20:63822452-63822474 CCTCCTGTGCTCCTTTGTCGGGG - Intronic
1176616609 21:9031688-9031710 CCTGATTTACACCTGTGTACTGG - Intergenic
1176708520 21:10131944-10131966 CCTGATTTACACCTGTGTACTGG + Intergenic
1176876947 21:14139834-14139856 CCTCCTTAGAACCTTTGTACTGG - Intronic
1178961118 21:37066215-37066237 TCTCATTTGCACATTTCTCACGG + Intronic
1180096832 21:45559574-45559596 TCTGATTTGCAGCTCTGTCCAGG + Intergenic
1180292611 22:10859209-10859231 CCTGATTTACACCTGTGTACTGG + Intergenic
1180456135 22:15513611-15513633 CCTGATTTACACCTGTGTACTGG + Intergenic
1180495416 22:15888631-15888653 CCTGATTTACACCTGTGTACTGG + Intergenic
1182706489 22:32284291-32284313 CCTCATTTGGACAGTTGTTCAGG + Intergenic
1183078707 22:35442754-35442776 TCTCATCTGCACCTTTGCCATGG + Intergenic
1184394811 22:44227357-44227379 CCTCATTTGGACAGTTGTTCAGG + Intergenic
1184703745 22:46195993-46196015 CCACGTCTGCACCTTTGCCCAGG - Intronic
1185193238 22:49452002-49452024 CCCCAGTTGTTCCTTTGTCCAGG + Intronic
949432997 3:3998752-3998774 CCTTATTTACACATTTCTCCAGG - Intronic
950482704 3:13254488-13254510 CCTCACTAACACCTTTGTGCAGG - Intergenic
951187043 3:19725363-19725385 CCTTATTTGCATTTTTGTCTGGG + Intergenic
956072835 3:65472688-65472710 TCTCATTTGCATCTCTGGCCTGG - Intronic
957448305 3:80343765-80343787 ACTCATTTGCACCCTTGACCTGG + Intergenic
957501972 3:81068896-81068918 CCTTATTTGCACTTCTGTCTAGG + Intergenic
959286885 3:104426126-104426148 CCTCATTTGCAAATTAGGCCAGG - Intergenic
961072342 3:123944775-123944797 TGTCATTTGCACCTTTGTTCTGG + Intronic
961323780 3:126097599-126097621 CCTCACTTGTACTTTTGCCCTGG + Intronic
963818328 3:149858724-149858746 GCTTATTTGCAACTTTGTTCTGG - Intronic
968294028 3:197559755-197559777 CCTCAGTTGGCCCTTTCTCCTGG - Intronic
970330207 4:14974850-14974872 AGTCATTTGCACTTTTATCCAGG - Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
972316003 4:37926454-37926476 CTTCACCTGCATCTTTGTCCAGG + Intronic
972429960 4:38971763-38971785 CCTCAATTTCACCTGTGTTCAGG - Intronic
974987879 4:69051787-69051809 CCTTATTGGCACCTTTGTTCTGG + Intronic
975396127 4:73875274-73875296 CCTCATTTTCACCTTTGAAAAGG + Intergenic
975489528 4:74973554-74973576 CCTCATCTGCATCTGAGTCCTGG + Intronic
977225888 4:94391308-94391330 CCTGTTTTCCACCTTTGCCCAGG - Intergenic
978865082 4:113497599-113497621 CCTCATTTCTTCCTTTGACCGGG + Intronic
978977036 4:114890229-114890251 CCACATTTGTACCATTTTCCAGG + Intronic
981838779 4:149086459-149086481 CCTCATTGGCACCTTTATAAAGG + Intergenic
982405018 4:155009698-155009720 CCTCATTTGCAGCTATGGCATGG + Intergenic
983871097 4:172826135-172826157 CTTCATTTGCACTCTTGTCCTGG - Intronic
985893695 5:2736988-2737010 CCTCATTTGTCCTCTTGTCCTGG + Intergenic
986816471 5:11417810-11417832 AAACATTTGCACCTTTGTCCAGG + Intronic
987263231 5:16224913-16224935 CCTCCTTTGCAACTTTATTCTGG - Intergenic
990748910 5:58990659-58990681 CCTTATTTGCTCCTTTGCCAAGG - Intronic
995093871 5:108212910-108212932 CCACAATTGCTCCTTTCTCCAGG + Intronic
1001955775 5:175847282-175847304 CCTCATTTGCAAAGTTTTCCAGG - Intronic
1004791490 6:19031759-19031781 CCTCATTTGTAGCTTCTTCCCGG - Intergenic
1007996144 6:46310000-46310022 CTAAATTTGCACCTTTGTCATGG + Intronic
1008480298 6:51978755-51978777 CCTCATCTGCACATTCTTCCTGG + Intronic
1017676916 6:156823570-156823592 CCTCTTTTGAACCATTGTTCGGG - Intronic
1019009226 6:168828040-168828062 CCTCATTTCCACCTAAGGCCTGG + Intergenic
1019714220 7:2530914-2530936 CCACCTCTGCACCTTTGCCCAGG - Intergenic
1020427644 7:8087237-8087259 CCTCATGTTCACCCATGTCCAGG - Exonic
1022193916 7:28045089-28045111 CCTAATTTTCACCTTCCTCCTGG - Intronic
1023320679 7:38994438-38994460 CCTCATTTGCACCTTTGTCCTGG - Intronic
1023752925 7:43388989-43389011 CATCACTGGCACCTTGGTCCAGG - Intronic
1024093823 7:45968688-45968710 CCCCCTTTGCCCCTTTGCCCAGG + Intergenic
1027218013 7:76196655-76196677 CCTCATCTGCACCTGTGTGCAGG - Intergenic
1029172248 7:98639429-98639451 CCACATCTGCACATCTGTCCAGG + Intergenic
1030281301 7:107778242-107778264 CTTCATCTTCACCATTGTCCTGG - Exonic
1035305318 7:157928140-157928162 CCTCATCTGCACCTTCCTTCTGG - Intronic
1035391888 7:158509632-158509654 CCTCATTTCCATCTCTGTCATGG + Intronic
1036603768 8:10288079-10288101 CCTCATTTTCACTTTTGTATGGG - Intronic
1037582164 8:20252168-20252190 CCTCATTTCCACGTGTGACCGGG + Intronic
1038046724 8:23771902-23771924 CTTCATCTCCACCCTTGTCCAGG - Intergenic
1039116069 8:34092425-34092447 CCTCATTCTCTCCTTTGTCAAGG + Intergenic
1040556121 8:48478821-48478843 CCACATTTGTTCCTTTGTTCAGG - Intergenic
1045686680 8:104719937-104719959 CCTCATTTTCACTCTTCTCCAGG - Intronic
1045704800 8:104909944-104909966 CCTCATTTGCCTTTTTGTTCAGG + Intronic
1047277020 8:123413782-123413804 CCTTATTTGCAGCTTTTCCCAGG - Intronic
1048108060 8:131433611-131433633 CCTTATTTTCACCTTTGTTCAGG - Intergenic
1053645487 9:40117457-40117479 CCTGATTTACACCTGTGTACTGG + Intergenic
1053760227 9:41346070-41346092 CCTGATTTACACCTGTGTACTGG - Intergenic
1054326505 9:63715358-63715380 CCTGATTTACACCTGTGTACTGG + Intergenic
1054539086 9:66258515-66258537 CCTGATTTACACCTGTGTACTGG - Intergenic
1057002194 9:91520392-91520414 GCTCATTTACAAATTTGTCCTGG + Intergenic
1057089566 9:92245003-92245025 CCTCATGTACACCTTTGATCAGG - Exonic
1057124244 9:92603668-92603690 CCTCATCTGCACCCCTGCCCTGG + Intronic
1057350470 9:94293048-94293070 CATCTTCTGGACCTTTGTCCAGG + Exonic
1059284710 9:113162489-113162511 CCTCATTTTCCCCTTTGCCTAGG + Intronic
1061043684 9:128153289-128153311 CCTCATATCCACCTCTGTCCAGG + Intronic
1202793281 9_KI270719v1_random:100913-100935 CCTGATTTACACCTGTGTACTGG + Intergenic
1190028468 X:46948296-46948318 CCTGACCTACACCTTTGTCCTGG + Intronic
1197147572 X:123186031-123186053 CCTCATTTGCATCTTTCTTGTGG + Intronic
1197283119 X:124561582-124561604 CCTAATTTTCACCCTTGGCCAGG + Intronic
1198619486 X:138490404-138490426 CATCATTTGGACCGTTTTCCAGG - Intergenic
1199591971 X:149475925-149475947 CCTCACTAGCACCTTGGTTCTGG + Intergenic
1199943926 X:152650711-152650733 AGACATTTGCACCTTTGTACAGG + Intronic
1201400189 Y:13596588-13596610 CATCTTTTGTCCCTTTGTCCTGG + Intergenic