ID: 1023320933

View in Genome Browser
Species Human (GRCh38)
Location 7:38996867-38996889
Sequence TGTCCATTCATTAAAGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023320933_1023320940 -1 Left 1023320933 7:38996867-38996889 CCCCCACCTTTAATGAATGGACA 0: 1
1: 0
2: 0
3: 12
4: 92
Right 1023320940 7:38996889-38996911 AGAGCACATGGAATCTACCTGGG 0: 1
1: 0
2: 1
3: 24
4: 292
1023320933_1023320939 -2 Left 1023320933 7:38996867-38996889 CCCCCACCTTTAATGAATGGACA 0: 1
1: 0
2: 0
3: 12
4: 92
Right 1023320939 7:38996888-38996910 CAGAGCACATGGAATCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023320933 Original CRISPR TGTCCATTCATTAAAGGTGG GGG (reversed) Intronic
902352112 1:15864340-15864362 TGTACTTTTAGTAAAGGTGGTGG + Intronic
906638557 1:47427044-47427066 TGTCAATCCATTCAGGGTGGTGG + Intergenic
908831170 1:68179989-68180011 TGCCCATTCAGTAGAGGTGGTGG + Intronic
909214967 1:72875399-72875421 TGTGCATTCAGTAATGGTAGGGG - Intergenic
916335689 1:163668793-163668815 TCTCCATTCATCAAATATGGTGG + Intergenic
917720040 1:177778544-177778566 TGTCCATACACTAAATATGGGGG - Intergenic
917916411 1:179706827-179706849 TATCTATTCTTTGAAGGTGGTGG + Intergenic
918264886 1:182832565-182832587 TGTCCACTCATTCAAGCTGAGGG - Intergenic
920944571 1:210516137-210516159 TGTCCAGTCATAAATGGTGCTGG - Intronic
1064617612 10:17178243-17178265 TGTCCTTTCATTCAAAGTGCTGG + Intronic
1064718289 10:18200427-18200449 TTTCCATTCATGAAAGGAAGGGG + Intronic
1069809619 10:71148743-71148765 TCTCCATTCCTTAAAGGGGGAGG - Intergenic
1079712354 11:23701572-23701594 TGTCCATTAATTACATTTGGTGG - Intergenic
1080062511 11:27972027-27972049 TATTCACTCATAAAAGGTGGAGG + Intergenic
1083190429 11:61048113-61048135 GGCCCAATCATCAAAGGTGGGGG - Intergenic
1086722901 11:90144187-90144209 TCTTCATTCATTAAAGTTGGGGG - Intronic
1090617941 11:128533149-128533171 TATCCATTCCTTTAAGGTGGAGG - Intronic
1090765370 11:129871657-129871679 TGACCGTTCATCAGAGGTGGAGG - Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1093994419 12:25625986-25626008 TTTCCATTCAGTAAAGGAGGAGG - Intronic
1094241949 12:28238366-28238388 TTTCTTTTCATTAAAGGTGGGGG - Intronic
1095451359 12:42334111-42334133 AGTGGATTCAGTAAAGGTGGGGG + Intronic
1096035424 12:48464826-48464848 TGTCTATTCAATAATGGTGCTGG + Intergenic
1096301022 12:50427665-50427687 TTTCCATTACTTAAAAGTGGGGG - Intronic
1097045108 12:56181788-56181810 CATCCATTCATTGAAGGTGTCGG + Exonic
1097425967 12:59445480-59445502 TGTCCTTCCATTCAGGGTGGTGG + Intergenic
1097677727 12:62621085-62621107 TTTTCATTCATTAGAGATGGAGG + Intergenic
1098634553 12:72765619-72765641 AATCCATTCAATAAATGTGGGGG + Intergenic
1104681273 12:130753593-130753615 TGTCCAAATATTTAAGGTGGTGG - Intergenic
1106563261 13:30864452-30864474 TCTCCATTCAGGAAAGCTGGGGG - Intergenic
1109854674 13:68111350-68111372 GGTCCATTCATTCAAGGCAGTGG - Intergenic
1110866524 13:80402366-80402388 TTTACATTCATTACAGGTGCTGG + Intergenic
1114296787 14:21337044-21337066 TGTCCAGGCATGAAAGGTAGAGG + Intronic
1120046057 14:79807709-79807731 TGTTCACTCTTTAAAGGTAGGGG - Intronic
1123128916 14:105969973-105969995 TGTCCCTTCCTTAACGGTGGTGG + Intergenic
1130179936 15:81615464-81615486 TGTCCTTTTATTAAAGAGGGAGG + Intergenic
1131583379 15:93666878-93666900 TGTATTTTTATTAAAGGTGGGGG + Intergenic
1134075871 16:11290902-11290924 TCTCCATACATTAGAGTTGGTGG - Intronic
1134128244 16:11630899-11630921 TGTCCATGCATCAAAGGTAATGG - Intronic
1136089096 16:27905599-27905621 TGTCCATGTCTTAAAGGTGCTGG - Intronic
1136871370 16:33810898-33810920 TGTCCATCCCTTAACAGTGGTGG - Intergenic
1138996706 16:62463312-62463334 TGTACATTCCTTGAAGGAGGAGG - Intergenic
1139536467 16:67578137-67578159 TGTTCTTACATTAAATGTGGTGG - Intronic
1140959828 16:79901079-79901101 TGTCCATTCATTCAAGGCGTTGG + Intergenic
1203100802 16_KI270728v1_random:1305160-1305182 TGTCCATCCCTTAACAGTGGTGG + Intergenic
1146466464 17:33090472-33090494 TGTCCATTCATAAATGATTGAGG - Intronic
1149021574 17:51972549-51972571 GGTCCATCCATTAAAGGAAGTGG + Intronic
1149335320 17:55629737-55629759 TTCCCATTCAAAAAAGGTGGGGG - Intergenic
1151368509 17:73632098-73632120 TGGCCATGCCTTAAGGGTGGTGG - Intronic
1155464533 18:26120453-26120475 GGTCCAATCAACAAAGGTGGTGG - Intergenic
1158264647 18:55648834-55648856 TGTCCATCCATCAGAGGTGGTGG - Intronic
1158810517 18:61028530-61028552 TAACTATTCAATAAAGGTGGGGG - Intergenic
1159142586 18:64415451-64415473 TGTCCATAGATGAAAGTTGGTGG + Intergenic
1160821679 19:1061955-1061977 AGTCCATTCACTGGAGGTGGAGG - Intronic
1166691769 19:44825924-44825946 AGTCCATTCATTGGAGGTGTGGG + Intergenic
925498140 2:4475653-4475675 TGTCCATTCATAAATGGAGCTGG - Intergenic
926181766 2:10651049-10651071 TTTACAGCCATTAAAGGTGGGGG + Intronic
928807534 2:35178460-35178482 TATCAATTAAGTAAAGGTGGTGG + Intergenic
931634479 2:64329212-64329234 TGCACTTTCTTTAAAGGTGGCGG - Intergenic
936686880 2:114837854-114837876 TGTCCATCTATTGCAGGTGGTGG + Intronic
940933191 2:159460594-159460616 TGGCTATTCATTAAAAATGGTGG + Intronic
941999794 2:171634441-171634463 TGCCCATTCATTAGAAGTGAGGG - Intergenic
943790803 2:191930520-191930542 TGTTCATCCACTAAAGCTGGAGG - Intergenic
946429373 2:219616526-219616548 TGCCCATTCAGGAAAGGTGATGG - Intergenic
946631128 2:221670592-221670614 TTACCATTCAGTAAATGTGGAGG + Intergenic
947252997 2:228129453-228129475 TGTGAATTCATTAAGGGTGAGGG + Intronic
1169167000 20:3432667-3432689 TATCCATTCCATCAAGGTGGTGG - Intergenic
1170247703 20:14241588-14241610 TGTACCTTTACTAAAGGTGGTGG - Intronic
1170678057 20:18500461-18500483 TGTCCCTTTGTTAATGGTGGAGG - Intergenic
1170882073 20:20305527-20305549 GGTCCATACCTAAAAGGTGGTGG + Intronic
1174718739 20:52788335-52788357 TTTCCATTCCCTAAATGTGGAGG + Intergenic
1177974839 21:27835292-27835314 AGTCCCTTCATTAATGGTTGTGG - Intergenic
1185126890 22:49016340-49016362 TTCCCATTTATTAAAGGTGCGGG + Intergenic
955996804 3:64687084-64687106 TGTCCACTGATTAAGGGTGAAGG - Intronic
958702825 3:97615599-97615621 TGTCCAAACAATAAAGATGGAGG - Intronic
959412377 3:106040686-106040708 TTTCCATTTATTTAAGTTGGTGG + Intergenic
960518576 3:118629435-118629457 TGTAAATCCAGTAAAGGTGGCGG - Intergenic
960573068 3:119204574-119204596 TCTCCATTAATTAAAAGTGTGGG + Exonic
964563047 3:158019653-158019675 TCTCCATTCATTAAAGTTTTTGG + Intergenic
966298690 3:178454306-178454328 TGTCCAATTATTTCAGGTGGAGG - Intronic
974854641 4:67445842-67445864 TCTCTATTCAGTAAAGGTGCAGG + Intergenic
974953986 4:68616371-68616393 TGATCTTTCAATAAAGGTGGAGG - Intronic
978253767 4:106667868-106667890 TGTCCATTTCTTAAAGATTGTGG + Intergenic
984635983 4:182110152-182110174 TGTCCATGAATAAAAGGTCGTGG + Intergenic
988549966 5:32191508-32191530 TGTCCACTCATTGAATCTGGGGG - Intergenic
995023949 5:107397687-107397709 TATCCATTCATTTAGGCTGGAGG + Intronic
995721532 5:115139487-115139509 TTTCCTTTCATTATAGGTGTTGG - Intronic
1007579846 6:42951229-42951251 TGTCCATGTGTTAATGGTGGAGG + Intergenic
1008134021 6:47752268-47752290 TGTCCTTATATTTAAGGTGGTGG + Intergenic
1008785751 6:55165388-55165410 AGTCCTTTCAATAAAGGTGTTGG + Intronic
1011300298 6:85866256-85866278 TGGCCATGTATTTAAGGTGGTGG - Intergenic
1015734435 6:136383138-136383160 TGTCCATTCATTAACTCTTGAGG - Intronic
1018408145 6:163509464-163509486 TGACCATTTAATAAAGGGGGGGG + Intronic
1023320933 7:38996867-38996889 TGTCCATTCATTAAAGGTGGGGG - Intronic
1030575039 7:111275209-111275231 TGCCCACTCATAAGAGGTGGAGG + Intronic
1033972262 7:147056566-147056588 TGTCCATCTATTACAGGTGTGGG + Intronic
1036791254 8:11721771-11721793 TGTACTTTCTCTAAAGGTGGTGG + Intronic
1042514037 8:69641333-69641355 TGTTCATTCATTAACTTTGGTGG + Intronic
1044249832 8:89993021-89993043 TGTCCATTTCTGAAAGGTGTGGG + Intronic
1052159846 9:25244179-25244201 TGTCAATTATTTAAATGTGGAGG + Intergenic
1056346139 9:85697059-85697081 TGTCCTTTGATTTATGGTGGAGG - Intronic
1057960553 9:99452184-99452206 TGTATTTTCATTAAAGGTGGTGG - Intergenic
1058692946 9:107534582-107534604 TGTACATTCATGAAGGGTGATGG + Intergenic
1060561634 9:124549763-124549785 TGTCCATTGTTAAAAGGAGGAGG - Intronic
1197251244 X:124218272-124218294 TGTTCATTAATTAAAGGGGGGGG + Intronic