ID: 1023321282

View in Genome Browser
Species Human (GRCh38)
Location 7:39000508-39000530
Sequence CTGTGGGTATGTTGAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 389}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023321282 Original CRISPR CTGTGGGTATGTTGAGAAAA TGG (reversed) Intronic
901083066 1:6594328-6594350 CTCTGGGCTTGTTGAGAAGAGGG - Intronic
902144771 1:14389209-14389231 TGGTGAGGATGTTGAGAAAAAGG + Intergenic
902189329 1:14750637-14750659 CTCAGGCTATGTAGAGAAAATGG - Intronic
902320101 1:15656425-15656447 CTGTGTGTATTGTGAGAGAATGG + Intronic
904378686 1:30097074-30097096 CTGTGGTGGTGTTGAGAAATTGG + Intergenic
905434649 1:37948135-37948157 CTGCTGGTATGTTGATGAAAAGG - Intergenic
905486869 1:38305349-38305371 TGGTGGGGATGTGGAGAAAAGGG + Intergenic
905802450 1:40853763-40853785 CTGTGAGTATGTCCAGAGAAGGG - Intergenic
908626342 1:66047924-66047946 CTGTGGGTATGAAGAGCTAATGG + Intronic
909375848 1:74941147-74941169 TGGTGGGGATGTGGAGAAAAGGG - Intergenic
910230425 1:84981162-84981184 TGGTGAGGATGTTGAGAAAAGGG + Intronic
910852561 1:91663165-91663187 CTGGGGCCATGTTTAGAAAATGG - Intergenic
911614972 1:100000213-100000235 TGGTGAGTATGTGGAGAAAAAGG - Intronic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
912922277 1:113880750-113880772 CTGGAGGTATTTTGAGAGAAAGG - Exonic
913595646 1:120373573-120373595 ACATGGGTATGTGGAGAAAAAGG - Intergenic
914091630 1:144505403-144505425 ACATGGGTATGTGGAGAAAAAGG + Intergenic
914306971 1:146428772-146428794 ACATGGGTATGTGGAGAAAAAGG - Intergenic
914595135 1:149144339-149144361 ACATGGGTATGTGGAGAAAAAGG + Intergenic
916328530 1:163591115-163591137 TTGTGAGGATGTAGAGAAAAGGG - Intergenic
916615901 1:166439131-166439153 TGGTGAGGATGTTGAGAAAAGGG - Intergenic
917177853 1:172258397-172258419 CGGTGAGGATGTGGAGAAAAGGG - Intronic
917459086 1:175213017-175213039 CAGTGAGGATGTGGAGAAAAGGG - Intergenic
917857774 1:179115549-179115571 GTGTGGATATGTTGAGTAAAAGG - Intronic
918986419 1:191633759-191633781 TGGTGAGGATGTTGAGAAAAGGG + Intergenic
919272332 1:195363931-195363953 TTGTGAGGATGTAGAGAAAAGGG + Intergenic
919436614 1:197570542-197570564 CTGAGGGCATGTTTACAAAATGG + Intronic
920567524 1:206986808-206986830 CTGAGACTTTGTTGAGAAAAAGG - Intergenic
920770796 1:208883223-208883245 CTGGGGCTATGGTGAGACAAGGG - Intergenic
921457224 1:215386589-215386611 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924858657 1:247899036-247899058 CTGGGGCCATGTTTAGAAAATGG - Intergenic
1063918003 10:10903940-10903962 CTGTGGGTGTGATGAGTTAAGGG + Intergenic
1063978519 10:11435759-11435781 CTGTGCGTGTGTGGAAAAAAGGG + Intergenic
1064270823 10:13864453-13864475 AAGGTGGTATGTTGAGAAAAGGG - Intronic
1065437089 10:25714045-25714067 TTGTGGGTGTGTAGACAAAAGGG - Intergenic
1066036102 10:31486358-31486380 CTGTGGCCATGTAGAGAAAGTGG - Intronic
1066350634 10:34633811-34633833 TTGTGAGGATGTGGAGAAAAAGG - Intronic
1066795139 10:39111920-39111942 ATGGGGGCATGTTGGGAAAAAGG + Intergenic
1068861288 10:61850605-61850627 CTGGAGGCAAGTTGAGAAAAAGG - Intergenic
1069711790 10:70494143-70494165 CTGTGGCTCTCTGGAGAAAAAGG - Intronic
1069914749 10:71780553-71780575 CTGGGGGAAAGTTGAGCAAAGGG + Intronic
1071126552 10:82342402-82342424 TTGTGAGGATGTGGAGAAAAGGG - Intronic
1072667693 10:97406260-97406282 CAGTGGGAAGGCTGAGAAAAGGG + Intronic
1073402752 10:103272383-103272405 CTGTGTGCATGTTCAGTAAATGG - Intergenic
1073518585 10:104102523-104102545 TTGTGGGTGTGATGAGAGAAAGG + Intergenic
1073965768 10:108987784-108987806 ATGTGTGTTTGCTGAGAAAAGGG + Intergenic
1074084037 10:110193912-110193934 TTATGGGTATTCTGAGAAAATGG - Intergenic
1075918332 10:126189051-126189073 ATGTGGGCTTCTTGAGAAAAGGG - Intronic
1076502936 10:130951104-130951126 CTGTGGCTATGTTGAGAATTAGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077066742 11:644447-644469 CTGGGGGGACGTTGAGAAGAGGG - Exonic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1080435202 11:32234002-32234024 ATGAGGGTATGTTAACAAAATGG + Intergenic
1081657650 11:44868086-44868108 CTGTGGGGAGATGGAGAAAAAGG + Intronic
1082704812 11:56480312-56480334 CAGTGGCTATGTAGACAAAAAGG + Intergenic
1082771651 11:57212392-57212414 CTGAAGGTTTGTAGAGAAAATGG - Intergenic
1083673623 11:64313831-64313853 CTGGGGGTATGGGGAGGAAAGGG - Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085648487 11:78244793-78244815 CAGTGAGGATGTGGAGAAAAGGG + Intronic
1086182282 11:83967368-83967390 CAGTGAGGATGTGGAGAAAAGGG - Intronic
1087265926 11:96060973-96060995 CTCTGGGTCTGATGAGAAAGTGG + Intronic
1088009254 11:104979388-104979410 CTGTGGGAATGTTCAGGCAAAGG + Intergenic
1088013025 11:105026183-105026205 GTGTGGGAAGGTTGAGGAAAGGG - Exonic
1088053145 11:105543028-105543050 CTCTGGCCATGTTTAGAAAATGG + Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1090685213 11:129109557-129109579 CAGTGAGTATGCAGAGAAAAGGG - Intronic
1090804246 11:130192726-130192748 CTGTGTGTGTGTTAAGAAATAGG + Intronic
1090898314 11:131001084-131001106 CTGAGGGAAAATTGAGAAAAGGG - Intergenic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1092618363 12:10236049-10236071 CTGTGGTTTTGTTTACAAAAAGG - Intergenic
1093260708 12:16934085-16934107 CGGTGAGGATGTGGAGAAAATGG - Intergenic
1093408592 12:18837936-18837958 CTGAGGGTATTTTGAGGAACTGG + Intergenic
1093724142 12:22483731-22483753 ATGTGGGGAGGTTGAGAAAGAGG + Intronic
1094252834 12:28385797-28385819 CTGTGGATTTGTTGGGACAATGG + Intronic
1095178469 12:39120068-39120090 GGGTGGGGATGTTGTGAAAAGGG - Intergenic
1096403980 12:51329479-51329501 CTGTGGGTATGTGGAGGGGAGGG + Intronic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096655940 12:53092160-53092182 TTGTGGGTGTTTTGAGAATAGGG - Intergenic
1097295286 12:57956443-57956465 CAGTGGGAAAGATGAGAAAATGG + Intronic
1098104035 12:67050802-67050824 TTGTGGGTGAGTTGAGGAAAAGG - Intergenic
1098248800 12:68547236-68547258 CTGGGGCCATGTTTAGAAAATGG + Intergenic
1098249828 12:68558032-68558054 ATGTACGTATGTTCAGAAAATGG - Intergenic
1099016575 12:77350425-77350447 CTGTGTGTGTGTTGAGAGAAAGG + Intergenic
1099045718 12:77716363-77716385 CTGTGAGTTTCTTGAGAACATGG - Intergenic
1099281640 12:80656182-80656204 ATGTGGTTATGTTTAGAAATGGG - Intronic
1099524456 12:83702502-83702524 CTGGTAGTATGTGGAGAAAAGGG + Intergenic
1100515803 12:95326489-95326511 CTTGGGGGAGGTTGAGAAAAGGG + Intergenic
1100912669 12:99383237-99383259 CTGTGAGAATTTTGAAAAAAAGG + Intronic
1101383555 12:104235685-104235707 GTGTGGTTCTGTTGAGGAAAGGG + Intronic
1101670306 12:106865239-106865261 TTGTGAGGATGTGGAGAAAAGGG - Intronic
1106066854 13:26361236-26361258 CAGTTGGTATGTTTAGAAGAAGG - Intronic
1106391819 13:29341284-29341306 TGGTGGGGATGTTGTGAAAAGGG - Intronic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1106909782 13:34451361-34451383 CTGTGGGTTCCTTGAGGAAAAGG - Intergenic
1107805575 13:44150810-44150832 GTGTGTGTGTGTTGAGAAAGAGG - Intronic
1107885926 13:44874110-44874132 CTGTGTTTACGATGAGAAAACGG + Intergenic
1108269606 13:48747002-48747024 CTGTGATTTTGTTGAGTAAAAGG + Intergenic
1108461082 13:50667992-50668014 CTGTGGGTCTGATGAAACAAAGG + Intronic
1108517828 13:51219702-51219724 CTGGGGATATGTTGAGGAATAGG - Intergenic
1110828553 13:80002295-80002317 CTGTGTGTATGTTGAGGGGAGGG - Intergenic
1110954551 13:81537735-81537757 TGGTGAGTATGTAGAGAAAAAGG + Intergenic
1112107882 13:96261764-96261786 CTGTGGCTCTGTAGAGAATATGG + Intronic
1112268293 13:97946149-97946171 TGGTGGGTATGTGGAGAAATTGG - Intergenic
1112602243 13:100868398-100868420 CTGTGGGTATTTGGAGGATAGGG + Intergenic
1113990222 14:16022893-16022915 GTGTGGGTATTGTGAGAAAAAGG + Intergenic
1114687281 14:24545434-24545456 CGGTGAGGATGTGGAGAAAAAGG - Intergenic
1114877991 14:26747178-26747200 CGGTGAGGATGTAGAGAAAAAGG + Intergenic
1114966341 14:27965846-27965868 CTGTGGGTTTTTAGAGAATATGG + Intergenic
1115003508 14:28451202-28451224 TGGTGGATATGTGGAGAAAAGGG - Intergenic
1115206779 14:30915971-30915993 ATGTGTGTATATAGAGAAAAAGG - Intronic
1116088006 14:40266294-40266316 CTGAGGGGATGTGGAGAAATAGG + Intergenic
1117447660 14:55820267-55820289 CTGGGGCCATGTTTAGAAAATGG - Intergenic
1119869728 14:78006515-78006537 CTGTGAGTACCTTGAGGAAAAGG + Intergenic
1120036735 14:79706435-79706457 TTTTTGGTCTGTTGAGAAAAGGG + Intronic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121628877 14:95408304-95408326 GTGTGTGTGTGTTGGGAAAATGG - Intronic
1121821269 14:96969318-96969340 CTGTTAGGATGTAGAGAAAAGGG + Intergenic
1123190066 14:106560773-106560795 TTCTGGATATGTTGAAAAAATGG + Intergenic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1124270970 15:28280339-28280361 TTGTTGCAATGTTGAGAAAATGG + Intronic
1124713567 15:32034984-32035006 CTGTGGGAATGTGGAGAAGGGGG + Intronic
1124820334 15:33038953-33038975 GTGTGGGTATCTTGTTAAAAAGG + Intronic
1125870547 15:43097324-43097346 CTCTGCGTATGTTGAATAAATGG - Intronic
1126287690 15:47032919-47032941 CAGTGAGAATGTAGAGAAAAGGG - Intergenic
1126288375 15:47042867-47042889 CAGTGAGGATGTGGAGAAAAGGG - Intergenic
1127729588 15:61787223-61787245 CTTTTGGTATATAGAGAAAATGG - Intergenic
1128139759 15:65290812-65290834 CGTTGGGTATGTTGAGGACAGGG - Intronic
1128162570 15:65433872-65433894 CTGTGGGTATTTGGTGGAAATGG + Intergenic
1129044444 15:72721266-72721288 ATGTGGGTAGTTTAAGAAAAAGG + Intronic
1129127387 15:73454468-73454490 CTGTGAGTATGATTAGAGAAAGG + Intronic
1129778362 15:78252116-78252138 CTGAGGGCCTGTTGAGAAAGAGG + Intergenic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130688110 15:86056878-86056900 AAGTGGGGATGTTGACAAAAAGG + Intergenic
1131005639 15:88975484-88975506 CTGTGAGAATTCTGAGAAAAGGG - Intergenic
1131750992 15:95508023-95508045 CTGTGAGTATGTAGAGGAACTGG - Intergenic
1133329353 16:4962361-4962383 CTGTGGGTAGAGTGAAAAAAAGG + Intronic
1133361738 16:5179470-5179492 GTGAGGGTATGATGAGAAGATGG - Intergenic
1134081708 16:11329186-11329208 TTGCGGTTATTTTGAGAAAAAGG + Intronic
1134540657 16:15062192-15062214 ATGTGGGTATGTTGGTAAGAAGG - Intronic
1134772209 16:16819082-16819104 CTGTGGGGATGTTGATAATAAGG - Intergenic
1135141401 16:19925191-19925213 CAGTGAGGATGTTGAGAAATAGG - Intergenic
1137630784 16:49942706-49942728 CTGGAGGGATGTAGAGAAAAGGG + Intergenic
1138021897 16:53491655-53491677 GTTTGGTTATATTGAGAAAAGGG + Exonic
1138048114 16:53747325-53747347 TAGTGAGGATGTTGAGAAAAGGG - Intronic
1138541935 16:57693544-57693566 AAGTGGGTATGAAGAGAAAAAGG + Intergenic
1139129050 16:64118285-64118307 CTGTAGATATGTTGATAACATGG + Intergenic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140465975 16:75183034-75183056 GTGTGAGGATGTGGAGAAAAAGG + Intergenic
1140907859 16:79425073-79425095 CTTTGGGTATATGGGGAAAAAGG - Intergenic
1141203829 16:81917528-81917550 TGGTGGGGATGTGGAGAAAAGGG - Intronic
1141248356 16:82331986-82332008 CTGTGGGGATGCACAGAAAAGGG + Intergenic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1144328409 17:14203787-14203809 CTGTGGGAATGTTCAGAAAAAGG - Intronic
1146487214 17:33252835-33252857 CTGCGAGTATGTTGTTAAAATGG - Intronic
1146659966 17:34659102-34659124 CTCTGGGAATGGGGAGAAAATGG - Intergenic
1147809909 17:43160971-43160993 CTGGGGCCATGTTTAGAAAATGG - Intergenic
1148385601 17:47232467-47232489 CTGTGGTTATGTTGGCAAAGAGG + Intergenic
1148877597 17:50699768-50699790 CTGTGGGTGTATAGATAAAAGGG + Exonic
1151152999 17:72104235-72104257 CTGTGGGTTTGTTAAAAAACAGG - Intergenic
1151338796 17:73456545-73456567 GTGTGGGCATGCTGAGAGAATGG + Intronic
1152793553 17:82295050-82295072 CTGTGAGGATGTGGAGGAAATGG - Intergenic
1153364136 18:4235065-4235087 TTGTGGGTAAGCTCAGAAAAGGG - Intronic
1154408010 18:14113776-14113798 TGGTGAGTATGTGGAGAAAAGGG - Intronic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1156037976 18:32787264-32787286 CTGTAGGTATTTTAGGAAAATGG - Intergenic
1156359821 18:36375068-36375090 CTTTGGTTATGTATAGAAAATGG + Intronic
1158335192 18:56408514-56408536 CTGTTAGCATGTTTAGAAAATGG - Intergenic
1159631428 18:70752872-70752894 CTGGAGGTATGTAGAGATAATGG - Intergenic
1160675009 19:385560-385582 CCTTGGGTATGGGGAGAAAAAGG + Intergenic
1162042709 19:7980179-7980201 CTGTGGGTATCTTGTGAAGGCGG + Intronic
1162227837 19:9239137-9239159 TGTTGGGTATGTGGAGAAAAGGG - Intergenic
1162614827 19:11790490-11790512 CTGTGAGGATGTAGAGAAAAAGG + Intergenic
1163207955 19:15817711-15817733 CTGGGAGGATGCTGAGAAAAGGG - Intergenic
1163878484 19:19897080-19897102 CTGGGGCCATGTTTAGAAAATGG + Intergenic
1166424794 19:42668098-42668120 GTGTGTGTGTGTTGGGAAAAGGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168305387 19:55432477-55432499 CTGTGATGATGTTGTGAAAAGGG + Exonic
925604335 2:5642926-5642948 ACATGGGTATGTGGAGAAAAAGG - Intergenic
925610960 2:5702713-5702735 CTTTCGGTGTGTTGAGAACATGG + Intergenic
925613148 2:5720256-5720278 CTGTCGGAATTTGGAGAAAAAGG - Intergenic
925993471 2:9272192-9272214 TTGTGGGGATGTGGAGAAAAGGG - Intronic
926619130 2:15031341-15031363 CTGTGGACATGTTGAGATTATGG - Intergenic
926635388 2:15173611-15173633 CTGATGGTATGCTGAGAAAATGG - Intronic
927017838 2:18985155-18985177 CGGTGAGTATGTGGAGAAACTGG - Intergenic
928026861 2:27747107-27747129 TTGTGGGTCTTTGGAGAAAAAGG + Intergenic
928845851 2:35670806-35670828 TGGTGAGTATGTGGAGAAAATGG - Intergenic
929298997 2:40280366-40280388 CTGTGGGGCTTTTCAGAAAATGG - Intronic
929357891 2:41048700-41048722 CTTTGGGTATGTAGAAATAAAGG - Intergenic
930363805 2:50413539-50413561 CTGTGAGGATGTGGAGAAAAGGG + Intronic
930970463 2:57388938-57388960 CTGTGAGAATGTGGAAAAAATGG + Intergenic
931143851 2:59494390-59494412 TGGTGGGGATGTGGAGAAAAGGG - Intergenic
931534156 2:63253744-63253766 CTGTGAGGTTGTGGAGAAAAGGG + Intronic
933856856 2:86422624-86422646 TTGTGGGTATGTTGAGATACAGG + Intergenic
934663327 2:96154522-96154544 CAGTGGGTACGTAGAGGAAAAGG - Intergenic
935970979 2:108530725-108530747 CTGAGGCCATGTTTAGAAAATGG + Intergenic
938636539 2:133233857-133233879 CTGTAGGTATGTGGGGAGAAGGG - Intronic
938955128 2:136290284-136290306 CTGGAGGTAAGATGAGAAAAGGG - Intergenic
938955264 2:136291651-136291673 CTGGAGGTAAGATGAGAAAAGGG - Intergenic
939290787 2:140192331-140192353 CTTTGGGGGTGTGGAGAAAAAGG + Intergenic
940692822 2:156940850-156940872 CTGCAGGGATGTTGAGAAAGAGG - Intergenic
940959934 2:159773976-159773998 CTGAAGAAATGTTGAGAAAATGG - Intronic
941870039 2:170374371-170374393 GTGAGGGGATGATGAGAAAAGGG + Intronic
942090841 2:172489189-172489211 CTGGGCGTATGTTGAGAACATGG + Intronic
943135149 2:183900944-183900966 CTGTGGGTGAGTTGAATAAAAGG + Intergenic
943317310 2:186406080-186406102 CTATGGCTATGTTAAGAAAGAGG - Intergenic
944043438 2:195381516-195381538 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
944547074 2:200809705-200809727 CTCTGGAAATGTTGAGAAAGGGG + Intergenic
945378438 2:209108946-209108968 CAGTGAGAATGTGGAGAAAAGGG + Intergenic
946611183 2:221459540-221459562 CTGTGTGTGTGTTGGGAGAAGGG - Intronic
946759947 2:222983639-222983661 CTATGGGTACCTAGAGAAAAAGG - Intergenic
948224221 2:236296368-236296390 GGGTGGGTGTGTTGAGAATAGGG - Intergenic
948965836 2:241379448-241379470 CTGTGAGTATGTTAAAGAAAAGG - Intronic
1169948218 20:11012145-11012167 GTGAGGGTATGGTGAGAAAATGG - Intergenic
1170002508 20:11630709-11630731 TTGTGGGTAGGTTGTGAAATGGG + Intergenic
1170128849 20:12996975-12996997 GTGTATGTGTGTTGAGAAAAGGG + Intergenic
1170448056 20:16450646-16450668 CTGTGAGTTTCATGAGAAAAGGG + Intronic
1170964443 20:21053404-21053426 CTGGGGGCATGCTGAGACAAAGG + Intergenic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1171813606 20:29764011-29764033 GTGTGGGCATTGTGAGAAAAAGG - Intergenic
1171904849 20:30892688-30892710 GTGTGGGCATTATGAGAAAAAGG + Intergenic
1173957170 20:47042604-47042626 CTGTGGGTTCTTTGAGATAAGGG - Intronic
1174437830 20:50523759-50523781 CTGTGGGGATGCTCAGGAAAAGG + Intronic
1175379162 20:58550851-58550873 CTGTGGATGTGATCAGAAAACGG + Intergenic
1177354906 21:19995901-19995923 CTGGGGCTATGTTTGGAAAATGG - Intergenic
1179670494 21:42943468-42943490 CTGGGGCCATGTTTAGAAAATGG - Intergenic
1180317049 22:11284633-11284655 GTGTGGGTATTGTGAGAAAAAGG - Intergenic
1182240727 22:28914087-28914109 CTTTGGGTCCTTTGAGAAAAAGG - Intronic
1182608577 22:31527352-31527374 CTGTGTGTGTGTAAAGAAAAAGG + Intronic
1183263380 22:36810778-36810800 TTTTGGGTATGTTCAGAAAGGGG - Intronic
1183952290 22:41358519-41358541 CTGGGGGAATGCGGAGAAAAGGG + Exonic
1184058892 22:42070184-42070206 ATGTGGGTATGTGGAGAGACAGG - Intronic
949790586 3:7787690-7787712 CTCTGGGTATAATGAGAAAATGG - Intergenic
950595628 3:13978695-13978717 CTCTCGGTATGAAGAGAAAAAGG - Intronic
951417109 3:22438213-22438235 CTGTGAGAATGTGAAGAAAAAGG - Intergenic
951914527 3:27786318-27786340 CTGTGAGTCTTTTGAGGAAATGG + Intergenic
952164307 3:30729602-30729624 ATGTGGGTATGTTCAAAAACTGG - Intronic
952204734 3:31169883-31169905 TTGAGGGCATGTGGAGAAAAGGG - Intergenic
952685773 3:36146754-36146776 CTGTGTCTATGTGGAGAAATTGG + Intergenic
952804397 3:37333783-37333805 CTGTACTTATGTTGAGAAAAGGG + Intronic
954351147 3:50045002-50045024 CTATGTGCAGGTTGAGAAAAAGG + Intronic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
954523084 3:51247241-51247263 ATGTGGGTTTGTTCAGAAGAAGG + Intronic
955840311 3:63105860-63105882 CTGTGGGTTCCTTGAGAAAAAGG - Intergenic
956562709 3:70598659-70598681 CTGTGAGTGTGTTGAGTAATGGG + Intergenic
956979587 3:74620456-74620478 TAGTTGATATGTTGAGAAAAAGG + Intergenic
957938438 3:86973925-86973947 CTGTGTGTATCTGTAGAAAAGGG - Intronic
958721813 3:97852810-97852832 TGGTGAGTATGTAGAGAAAAGGG - Intronic
958857645 3:99405873-99405895 TGGTGAGGATGTTGAGAAAAGGG + Intergenic
960317134 3:116191696-116191718 ATGCAGGAATGTTGAGAAAATGG - Intronic
961332884 3:126153443-126153465 CTTTGGGAATGATGACAAAATGG - Exonic
962058512 3:131900349-131900371 TGGTGAGTATGTGGAGAAAAGGG + Intronic
962169669 3:133087718-133087740 CTTCGGGTATCTTGAGAACAAGG + Intronic
962277452 3:134026905-134026927 CTGGGGCCATGTTTAGAAAATGG + Intronic
962690473 3:137892164-137892186 CTGTGTGTATGCTAAGGAAAGGG - Intergenic
963686140 3:148436722-148436744 TGGTGAGTATGTGGAGAAAAGGG - Intergenic
963794124 3:149614492-149614514 ATGTGGGTATGTTCTGAGAAGGG - Intronic
963813703 3:149806266-149806288 TAGTGGGCATGTGGAGAAAAGGG - Intronic
964259243 3:154816027-154816049 ATGGGGGTATGTTGGGCAAAGGG + Intergenic
964581777 3:158247419-158247441 CTGTGGTCATTTGGAGAAAACGG + Intronic
965172830 3:165290163-165290185 CTGTGAGATTGTAGAGAAAAAGG - Intergenic
965318494 3:167221922-167221944 TGGTGGGGATGTGGAGAAAAGGG + Intergenic
965853141 3:173055135-173055157 CACTGAGAATGTTGAGAAAATGG + Intronic
966507494 3:180723173-180723195 CTTTGGGAATGTTATGAAAATGG + Intronic
966628699 3:182048179-182048201 CGGTGTGGATGTTGTGAAAAGGG - Intergenic
969834264 4:9826804-9826826 CTCTGGGAAAGATGAGAAAATGG + Intronic
971147019 4:23988418-23988440 CTGGGGGAATGTGGAGAAATAGG - Intergenic
971755562 4:30703448-30703470 CTCTCGGTATTTTCAGAAAAAGG - Intergenic
972181476 4:36472150-36472172 GTGTGGGTGTGTGGAGGAAAGGG + Intergenic
972217441 4:36912617-36912639 CTGGGGCCATGTTTAGAAAATGG + Intergenic
972271823 4:37518404-37518426 TGGTGTGGATGTTGAGAAAAGGG - Intronic
972669927 4:41205389-41205411 TTTTGGGAATGGTGAGAAAATGG - Intronic
973144990 4:46814040-46814062 TGGTGGGGATGTGGAGAAAAGGG + Intronic
973830100 4:54750569-54750591 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
974539381 4:63214139-63214161 CAGTGAGGATGCTGAGAAAAAGG - Intergenic
975032885 4:69644739-69644761 CTCTGGGTATGTTAAGTAATTGG - Intronic
975501688 4:75093233-75093255 TGGAGGGTATGTGGAGAAAAGGG - Intergenic
976650473 4:87428829-87428851 CTGTGGGGATGTTGACAATGCGG - Intronic
977341980 4:95770715-95770737 CACTGGGGATGTGGAGAAAAGGG + Intergenic
977411247 4:96668044-96668066 CAGTGGGTGTGTTGGGAAATGGG + Intergenic
977871149 4:102092311-102092333 TTGTGGGTAGTTTGAGGAAAGGG - Intergenic
977972798 4:103230728-103230750 CTGGGGCTATGTTTGGAAAATGG + Intergenic
978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG + Intergenic
979381430 4:120011249-120011271 CTGTGTGTCTGGTGAGAATATGG - Intergenic
979871776 4:125832447-125832469 TGGTGTGTATGTGGAGAAAAAGG + Intergenic
980074485 4:128279998-128280020 CTTTGGGTATGTTGCAAAATAGG - Intronic
980225966 4:129986119-129986141 CTGTGAGTATGCTAAGAAAGAGG + Intergenic
981125682 4:141103501-141103523 CTGTGGGTATTTTTATAGAACGG + Intronic
981445722 4:144836199-144836221 TTGTGGTAATGTAGAGAAAAGGG - Intergenic
982810114 4:159814630-159814652 CAGTGTGTATGTGGAGAATAGGG + Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
984805480 4:183747454-183747476 CTGTGGGTATCTGGAAAAACTGG + Intergenic
985751241 5:1677561-1677583 TGGTGAGGATGTTGAGAAAAGGG - Intergenic
987069149 5:14319642-14319664 CTGTAAGTACATTGAGAAAAAGG + Intronic
987187710 5:15442427-15442449 GTGTGTGTGTGTTGAGATAAAGG + Intergenic
987323439 5:16791290-16791312 CTGTGGGAATTAAGAGAAAATGG - Intronic
987551431 5:19387144-19387166 TTATGTGTATGTTTAGAAAATGG - Intergenic
987753318 5:22068692-22068714 CTATGGGAATGTTTACAAAAAGG + Intronic
987912929 5:24171977-24171999 GTTTGTTTATGTTGAGAAAAGGG - Intronic
988134633 5:27154991-27155013 CTTTGGGGATTTGGAGAAAAGGG - Intergenic
989148971 5:38279226-38279248 TTGTGAGGATGTGGAGAAAAGGG + Intronic
989439339 5:41451950-41451972 TTGTGTGCATGTTGAGAAACAGG + Intronic
989526443 5:42458991-42459013 CTGTGAGGTTGTAGAGAAAAGGG + Intronic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
992064111 5:73088375-73088397 CAGTGTCTATGTTGAAAAAAAGG + Exonic
992190764 5:74289450-74289472 CTCTGGGTATGTTGACAGCAAGG + Intergenic
992285937 5:75235896-75235918 AAGTGGGTATGATGAGGAAAGGG + Intronic
993331130 5:86601593-86601615 CTGTAAGAATGTGGAGAAAAGGG + Intergenic
993971526 5:94425748-94425770 CTGTGAGGATCTGGAGAAAAGGG - Intronic
994430276 5:99650060-99650082 CAGTGGGGATGTGGTGAAAAGGG + Intergenic
994629857 5:102271884-102271906 GTGTGTATATGTTGCGAAAAAGG + Intronic
994798292 5:104335156-104335178 CGGTGGGTGTGTTTAAAAAAAGG + Intergenic
994844381 5:104968164-104968186 CAGATGGTATGTTCAGAAAATGG - Intergenic
995019350 5:107349572-107349594 TGGTGAGTATGTGGAGAAAAGGG - Intergenic
995576967 5:113547171-113547193 CTGTGTGTATTTTGAGCAGAAGG - Intronic
996598338 5:125230980-125231002 GTGAGGCTGTGTTGAGAAAAGGG - Intergenic
996876409 5:128245325-128245347 TTTTGTGTATGGTGAGAAAAGGG + Intergenic
997188795 5:131909926-131909948 CGGTGAGGATGTGGAGAAAAGGG + Intronic
997776575 5:136613492-136613514 TAGTGAGTATGTGGAGAAAAGGG + Intergenic
998869745 5:146540473-146540495 CTGTGTGTATGCTGAGAATAGGG + Intergenic
999213703 5:149913708-149913730 CTGCAGTTAAGTTGAGAAAAAGG + Intronic
999750794 5:154627041-154627063 CAGTGGGGTTGTTGAGAACATGG - Intergenic
1000524427 5:162339016-162339038 CTCTTGGTATGTGGAGAAGACGG - Intergenic
1000543749 5:162573062-162573084 ATGTGGGTATAGTTAGAAAATGG + Intergenic
1000790205 5:165597381-165597403 CAGTCGGGATGTTGAGAAATGGG - Intergenic
1001953411 5:175831684-175831706 CTGTGGGTATCTTGAGGGCAGGG - Intronic
1001969443 5:175942608-175942630 CAGTGAGGATGTAGAGAAAAGGG + Intronic
1002247992 5:177901145-177901167 CAGTGAGGATGTAGAGAAAAGGG - Intergenic
1004753246 6:18584886-18584908 CTGTGGGCATTTTGAGAGCAAGG + Intergenic
1004976975 6:20979381-20979403 CTTTGGGTACATTGAGAAACAGG + Intronic
1005920750 6:30398353-30398375 TTGTGAGGATGTGGAGAAAAGGG - Intergenic
1007457743 6:41993287-41993309 CTGTGAGGATGAGGAGAAAAGGG - Intronic
1007461250 6:42020670-42020692 CTGTGGGAATTCTGAGAGAAGGG - Intronic
1008317680 6:50066378-50066400 CTATGGGCATGTAAAGAAAATGG - Intergenic
1008340770 6:50361488-50361510 CTGTGGCCATTTTGAGAAGAAGG + Intergenic
1009955699 6:70449895-70449917 CGGTGAGGATGTGGAGAAAAAGG - Intronic
1010930584 6:81797775-81797797 TGGTGGGGATGTGGAGAAAAGGG - Intergenic
1011520938 6:88205281-88205303 TTGTGAGGATGTGGAGAAAAGGG + Intergenic
1013573881 6:111459775-111459797 CAGTGGGGCTGTGGAGAAAAGGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1015187848 6:130438918-130438940 ATGTGGGTATGTGAAGAACAGGG + Exonic
1015337383 6:132055729-132055751 CAGTGAGTATGTTGAGAAATGGG + Intergenic
1016099602 6:140081972-140081994 TTGTGGGTATTTTGAAGAAAAGG + Intergenic
1017570568 6:155740644-155740666 TGGTCTGTATGTTGAGAAAAAGG - Intergenic
1017726139 6:157277088-157277110 CTGTGGGAGAGTTGAGAAAGAGG + Intergenic
1017806473 6:157950855-157950877 CAGTGAGGATTTTGAGAAAAAGG + Intergenic
1019262646 7:90229-90251 CTTTGTGTATGTTGGGAAACAGG + Intergenic
1021367422 7:19797038-19797060 TGGTGGGCATGTAGAGAAAAGGG - Intergenic
1022438089 7:30409124-30409146 CTCTGGGTATCTTAAGCAAATGG - Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1024361179 7:48470173-48470195 CTGTGTGAATGTTCATAAAAGGG - Intronic
1026787632 7:73311865-73311887 CTGTGGGTATGGTGAGTCAAAGG + Intergenic
1027008836 7:74723830-74723852 TGGTGACTATGTTGAGAAAAGGG + Intronic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028113494 7:86971394-86971416 CTGCAGGTTTCTTGAGAAAATGG - Intronic
1028253509 7:88563935-88563957 CTGTGGGTATGTTCTCAAAATGG - Intergenic
1029314799 7:99701581-99701603 CAGTGAGAATGTGGAGAAAAGGG - Intronic
1029486542 7:100846142-100846164 CTGAGGCCATGTTTAGAAAATGG + Intronic
1032329432 7:130963768-130963790 CTGGGGGTGAGTTGAGAAAGTGG - Intergenic
1032941227 7:136794917-136794939 CTGTGAGGATGTGGAGAAAAGGG + Intergenic
1033123215 7:138684619-138684641 TTGTGGGAATGTGGAGAAAAAGG + Intronic
1033412989 7:141137069-141137091 TTGGGGGGATGTGGAGAAAAGGG + Intronic
1035246783 7:157567712-157567734 GTGTGTGTGTGTTGAGACAAAGG + Intronic
1035551195 8:527726-527748 GTGTGTGTATGGTGAGAAATAGG - Intronic
1035823935 8:2624263-2624285 TTGTGGAGATGTGGAGAAAAGGG + Intergenic
1036189398 8:6656621-6656643 CTGTAGGTCTGTTGTGCAAAAGG - Intergenic
1039712255 8:40067580-40067602 CAGTGTGTATGATAAGAAAATGG + Intergenic
1040510835 8:48092852-48092874 TGGTGAGTATGTGGAGAAAAGGG - Intergenic
1042425849 8:68647308-68647330 CCGTGAGGATGTAGAGAAAAGGG + Intronic
1042848963 8:73196810-73196832 CTGGGGTTAGATTGAGAAAAGGG + Intergenic
1043108671 8:76149860-76149882 CAGTGGTTATGTTGAGATGATGG - Intergenic
1044394691 8:91697003-91697025 TTGTGAGGATGTGGAGAAAAGGG - Intergenic
1044752834 8:95432484-95432506 CTGTGTGTGTGTTCAGAATATGG + Intergenic
1046332059 8:112730633-112730655 CCGTGAGCAAGTTGAGAAAACGG - Intronic
1048330591 8:133467980-133468002 CGGTGAGGATGTGGAGAAAATGG + Intronic
1050824162 9:9923142-9923164 GTGTGTGTATGTACAGAAAAAGG + Intronic
1051765252 9:20515578-20515600 CGGTGAGTATGGGGAGAAAAAGG - Intronic
1052114409 9:24632286-24632308 TGGTGGGTATGTGGAGAAGAGGG - Intergenic
1052174726 9:25444172-25444194 CTGTTGGTATGTTGTAAAAAAGG + Intergenic
1052692031 9:31827177-31827199 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
1053361434 9:37489529-37489551 CTTTGTCTGTGTTGAGAAAATGG + Intronic
1053442636 9:38128607-38128629 ATGGGGGTATGTTGAAAAGAAGG + Intergenic
1055467612 9:76581113-76581135 CTGAGAGGATGTAGAGAAAAGGG - Intergenic
1056329375 9:85509177-85509199 CAGTGGTTATGCTAAGAAAAGGG + Intergenic
1057048433 9:91903657-91903679 CTTTGGGGATGTTGAGAATGTGG - Intronic
1057667403 9:97056581-97056603 CTGAGGTGATGTGGAGAAAAAGG - Intergenic
1057931143 9:99194348-99194370 TTGTGGGTATTTTTTGAAAATGG + Intergenic
1058211509 9:102175098-102175120 CTTTGGATATGGTGAGAAATAGG + Intergenic
1058218970 9:102272066-102272088 CTGTGAGACTGTGGAGAAAAGGG - Intergenic
1058313036 9:103529910-103529932 TGGTGGGGATGTGGAGAAAAGGG + Intergenic
1059426189 9:114222373-114222395 CTGGGGGTTTGATGAGAGAAGGG - Intronic
1186108686 X:6232471-6232493 CTATTGGGATGCTGAGAAAATGG + Intergenic
1186680904 X:11872890-11872912 CTGTGAGGATGTGGAGAAATTGG + Intergenic
1187037600 X:15558366-15558388 CTGTGGGTCCATTGAGAAAGAGG - Intergenic
1187379425 X:18786938-18786960 CTTTAGGTATCCTGAGAAAATGG - Intronic
1187457531 X:19455690-19455712 CTTTTGTTATTTTGAGAAAATGG + Intronic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1188739426 X:33759974-33759996 TGGTGAGTATGTGGAGAAAAGGG - Intergenic
1189671857 X:43419427-43419449 TTGTGGGTATGTTGGCAAATGGG - Intergenic
1191058437 X:56268438-56268460 TGGTGAGTATGTGGAGAAAAGGG - Intronic
1192760055 X:74087125-74087147 TGGTGGGGATGTGGAGAAAAGGG + Intergenic
1192769893 X:74177883-74177905 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
1193408434 X:81133212-81133234 CTGTGAGGTTGTGGAGAAAAAGG + Intronic
1193907716 X:87263073-87263095 TGGTGGGGATGTGGAGAAAAGGG + Intergenic
1193933732 X:87589163-87589185 TGGTGGGGATGTGGAGAAAAGGG + Intronic
1194634282 X:96324693-96324715 ATGTGGATTTGTTGAGGAAAAGG + Intergenic
1195501517 X:105606410-105606432 TTGTGAGGATGTGGAGAAAAAGG + Intronic
1195585049 X:106555504-106555526 TTGTGGGGATGTGGAGAAAAAGG + Intergenic
1197180346 X:123528959-123528981 CAGTGAGGATGCTGAGAAAAGGG - Intergenic
1197373097 X:125648206-125648228 TTGTGAGGATGTAGAGAAAAGGG - Intergenic
1197665263 X:129216412-129216434 CTGTGGGTTCCTTGAGAATAGGG - Intergenic
1198069626 X:133135188-133135210 CAGTGGGTATATTGAAGAAAAGG + Intergenic
1198729228 X:139709904-139709926 TTGTGAGGATGTGGAGAAAAGGG - Intergenic
1198895900 X:141454261-141454283 TGGTGGGGATGTAGAGAAAAGGG + Intergenic
1198943944 X:141988518-141988540 TTGTGAGGATGTGGAGAAAAGGG - Intergenic
1199041998 X:143125377-143125399 TTGTGGGGAAGTTGAGAAAAAGG - Intergenic
1199664621 X:150086954-150086976 CTGTGGCCATGCTGAGACAAAGG - Intergenic
1200272921 X:154703750-154703772 TTGTGAGGATGTGGAGAAAAGGG + Intronic
1200354724 X:155536186-155536208 CTGTGAGTATCTTGAGGATAGGG + Intronic
1200638317 Y:5684320-5684342 TGGTGAGTATGTGGAGAAAAGGG + Intronic
1201488711 Y:14518756-14518778 CTATTGGGATGATGAGAAAAAGG - Intergenic