ID: 1023323054

View in Genome Browser
Species Human (GRCh38)
Location 7:39020978-39021000
Sequence TCTTTTAAACAGTCTCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023323052_1023323054 0 Left 1023323052 7:39020955-39020977 CCTTATCATTTTTTTTAAAATGT 0: 1
1: 1
2: 20
3: 220
4: 2081
Right 1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG 0: 1
1: 0
2: 3
3: 25
4: 281
1023323051_1023323054 18 Left 1023323051 7:39020937-39020959 CCAGCATTTTCAATTTTTCCTTA 0: 1
1: 0
2: 5
3: 77
4: 661
Right 1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG 0: 1
1: 0
2: 3
3: 25
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023323054 Original CRISPR TCTTTTAAACAGTCTCTGGC TGG Intronic
900507436 1:3036736-3036758 TCTTGTAAACAGTCTCAGCAGGG - Intergenic
903927948 1:26844333-26844355 TCTCATAAACATTGTCTGGCCGG - Intronic
904146201 1:28394032-28394054 ACTGTAAAACAGCCTCTGGCAGG + Intronic
904263025 1:29301522-29301544 ACTGTAAAACAGCCTCTGGCAGG + Intronic
904722265 1:32519175-32519197 TCTGTAAAACAGCCTCAGGCAGG - Intronic
907313096 1:53551141-53551163 TCCTTTAAAAAATCACTGGCCGG - Intronic
908065186 1:60395728-60395750 TCTTCTAGACGGTCTTTGGCTGG + Intergenic
908324881 1:63014051-63014073 TTTTTTAAAGATTCTCGGGCAGG - Intergenic
908642237 1:66238184-66238206 TGCTTTGAACAGTCCCTGGCTGG - Intronic
908905521 1:69004488-69004510 TCTTTTGAAAAGTGTCTGTCGGG + Intergenic
909709313 1:78627455-78627477 TCTTTAAAAAAGTATATGGCTGG - Intronic
912912083 1:113772408-113772430 TTTTTTAAAAAGGCTTTGGCAGG - Intronic
913676009 1:121141102-121141124 ACTGTTAAACAGCCTCTGGGAGG - Intergenic
914027904 1:143929045-143929067 ACTGTTAAACAGCCTCTGGGAGG - Intergenic
914841972 1:151256047-151256069 TCTTTTGAAAAGTGTCTGGCTGG + Intronic
916406647 1:164504361-164504383 ACTTTAAAACAGCCTCAGGCAGG - Intergenic
918134161 1:181656187-181656209 TCTGTAAAACAGTCTGAGGCAGG + Intronic
918392270 1:184078635-184078657 TCTTCTAAAGAGTCTCAGCCAGG - Intergenic
920153372 1:203927799-203927821 ACTGTAAAACAGTCTCAGGCAGG - Intergenic
920463379 1:206159940-206159962 ACTGTTAAACAGCCTCTGGGAGG - Intergenic
920869738 1:209784110-209784132 TCTTATAACTATTCTCTGGCGGG - Intronic
920884430 1:209912853-209912875 TCTTTTACTCAGTCTCTGCAAGG - Intergenic
923352530 1:233123283-233123305 TCTTTTAAAAAACATCTGGCCGG + Intronic
1062863828 10:832337-832359 TCTTTTAAAAAAAATCTGGCCGG - Intronic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1064827498 10:19421538-19421560 GCTTTTAAACATTCTCTAACTGG - Intronic
1064998989 10:21320157-21320179 TATTTTAAAAATACTCTGGCTGG + Intergenic
1065297875 10:24293895-24293917 TCTTTGAAATAGTTCCTGGCCGG + Intronic
1066233440 10:33461259-33461281 TGTTTTAAAAAGTCTCTTGGTGG + Intergenic
1066269323 10:33807005-33807027 GCTTTTAAACAATCTGAGGCAGG + Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067665167 10:48271410-48271432 TGGGTTAAACAGTGTCTGGCTGG - Intronic
1068223495 10:54075079-54075101 TCTTTAAAAAATTCTCGGGCTGG + Intronic
1068912473 10:62393205-62393227 TCTGTAAAACAGCCTCAGGCAGG - Intronic
1070843706 10:79505532-79505554 TTCTATAAACAATCTCTGGCTGG + Intergenic
1072072885 10:91937022-91937044 TTTTTGAGACAGTCTCAGGCTGG + Intronic
1074116110 10:110458572-110458594 TCTTTTCAACAATATCTGGAGGG + Intergenic
1074304880 10:112267876-112267898 TTTTGTAAACAGACTATGGCTGG - Intergenic
1076490030 10:130852660-130852682 TCTGTTAAAAAGTTCCTGGCCGG - Intergenic
1077664014 11:4092418-4092440 TCTCTTTAAAAGTCTCTGGTGGG - Exonic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1079352881 11:19707594-19707616 ACTGTAAAACAGTCTCAGGCAGG - Intronic
1079825741 11:25190004-25190026 TCTTTTAAATAGTCTCAGGCCGG - Intergenic
1079861768 11:25681394-25681416 TCTTTCAAAAAGTTTCTGGTAGG + Intergenic
1083362808 11:62122923-62122945 TCCTATAAAGAATCTCTGGCCGG - Intergenic
1084111158 11:67014979-67015001 TCTTTTAAGTAGTTTGTGGCGGG - Intronic
1085089031 11:73693846-73693868 TTTTTGAAACAGTCTCAAGCTGG - Intronic
1085241039 11:75055902-75055924 ACTATAAAACAGTCTCAGGCAGG + Intergenic
1085772395 11:79337217-79337239 TTTTCTAAAAAGCCTCTGGCAGG - Intronic
1087544928 11:99573272-99573294 TGTTTTAAATAGTTCCTGGCCGG + Intronic
1089205738 11:116761079-116761101 TTTTTGAGACAGTCTCAGGCTGG + Intronic
1089728883 11:120508023-120508045 CTTTTTAAAAAATCTCTGGCCGG - Intergenic
1089825152 11:121268504-121268526 TCTTGTAGTCAGTCTCTAGCTGG + Intergenic
1090170707 11:124601484-124601506 TCTCTGGAACATTCTCTGGCTGG + Intergenic
1090713404 11:129408599-129408621 TCTCTGGAACACTCTCTGGCTGG + Intronic
1091504154 12:1050037-1050059 TCTTTTAAAATGTCATTGGCCGG - Intronic
1092498420 12:9021887-9021909 TCTGTAAAACAGCCTCAGGCAGG - Intergenic
1092838807 12:12518216-12518238 TCTTTAAGAAAGACTCTGGCTGG + Intronic
1093365450 12:18290794-18290816 TGTTTTAAACTGTGTCTTGCAGG + Intronic
1093619166 12:21266367-21266389 CCTTTTAATCAGTCTCTGGAAGG - Exonic
1094105038 12:26801930-26801952 TCTTGTAAATAGCCTATGGCTGG - Intronic
1094240455 12:28216937-28216959 AATTTTAAACATTCTCTGACAGG - Intronic
1094240594 12:28218906-28218928 AGTTTTAAACATTCTCTGACAGG + Intronic
1094684821 12:32700978-32701000 TCATTTAAAAAGTCTGTGGCCGG + Intronic
1094707114 12:32924991-32925013 TCTTTTGAAAAGTGTCTGTCTGG + Intergenic
1095822715 12:46496740-46496762 GCTGTAAAACAGTCTCAGGCAGG + Intergenic
1096659360 12:53114422-53114444 GATTTTAAACAGTTTCTGGCTGG + Intronic
1098108688 12:67098340-67098362 ACTGTAAAACAGTCTCAGGCAGG + Intergenic
1098348190 12:69528171-69528193 CCTTTTAAACATTCTATGGCTGG - Intronic
1100525355 12:95413992-95414014 TCTTTTAAGAAATTTCTGGCTGG - Intergenic
1100677487 12:96883550-96883572 ACTGTAAAACAGCCTCTGGCAGG - Intergenic
1100828752 12:98498794-98498816 TGTTTTAAAGGGTCTTTGGCTGG - Intronic
1101686913 12:107033438-107033460 TCTTTTATACTGTCTTTGTCTGG - Intronic
1101886553 12:108668460-108668482 TCTTTTAAAAATTGTCTAGCAGG + Intronic
1102752631 12:115308922-115308944 TTTTTTGAGCAATCTCTGGCTGG + Intergenic
1106048702 13:26169589-26169611 TCTTCTTAAGAGTCTCTTGCCGG + Intronic
1107080587 13:36370338-36370360 TCTTAGCACCAGTCTCTGGCAGG + Intergenic
1107294929 13:38898322-38898344 ACTATAAAACAGTCTCAGGCAGG - Intergenic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107728244 13:43321571-43321593 TCTGTTAAAAAGTCTCTAACAGG + Intronic
1108276703 13:48818129-48818151 TCTTTTAAACAGTCTAATACTGG + Intergenic
1108897963 13:55359086-55359108 TGTTTTAAGCATTTTCTGGCAGG + Intergenic
1109149789 13:58831530-58831552 TCTTTTAAACATTCTTTTACAGG + Intergenic
1109201612 13:59437560-59437582 TTTCTTAAACATTCTTTGGCAGG + Intergenic
1110799272 13:79676062-79676084 GCTTTTAAACATTCTTAGGCAGG + Intergenic
1112017790 13:95345733-95345755 TGTTTGAGACAGTCTCAGGCTGG + Intergenic
1112677387 13:101718586-101718608 TTTTTGAAAAAGTCTCTGGGTGG - Exonic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115433719 14:33349855-33349877 CCTTTTGTACAGTCTCTGGGCGG + Intronic
1115637032 14:35299695-35299717 TCTTTTAAAGAAACACTGGCAGG - Intronic
1116903831 14:50386624-50386646 TTTTTAAAAAAGACTCTGGCTGG + Intronic
1117441127 14:55760380-55760402 TCTTTAAAACAGCAGCTGGCTGG + Intergenic
1117456327 14:55900632-55900654 ACTATAAAACAGTCTCAGGCAGG - Intergenic
1117652890 14:57925062-57925084 TCTTTTTAACAAGCTCTCGCAGG + Intronic
1120553109 14:85895774-85895796 TCTTTTGGACAGTGTCTGTCGGG + Intergenic
1120712990 14:87812242-87812264 ACTGTAAAACAGTCTCAGGCAGG - Intergenic
1121847978 14:97191019-97191041 TTTTTTAAAGAATCTCCGGCCGG + Intergenic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1123966215 15:25461347-25461369 ACTGTAAAACAGTCTCAGGCAGG + Intergenic
1124182839 15:27493781-27493803 TGTTCTTAACAATCTCTGGCTGG - Intronic
1126962145 15:54008930-54008952 TTTTTTAAAGAGTTTCTGGGAGG + Intergenic
1127526427 15:59796848-59796870 TCTTTTAAAAATTCTCAGGTTGG - Intergenic
1128283820 15:66419221-66419243 TCCTTTAAAAATTATCTGGCTGG + Intronic
1128530039 15:68438717-68438739 TCTTTTGCACAGACTCTGGTAGG - Intergenic
1128556327 15:68634308-68634330 TCTTTTACTCACTCGCTGGCCGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130638843 15:85651499-85651521 TTTTTTAAAAAGTCACTGACTGG - Intronic
1130882105 15:88064193-88064215 TCTCTTAAAAAGCCTTTGGCAGG + Intronic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1134337768 16:13317108-13317130 TCTTTTCAAAACTCTCTGGTTGG + Intergenic
1135937087 16:26790830-26790852 GCTTTTAAACTTTCTTTGGCAGG + Intergenic
1138704107 16:58896480-58896502 TTTTGTGAACAGTGTCTGGCAGG - Intergenic
1140379632 16:74474793-74474815 TCTTTTCAACAATCTCAGTCTGG - Intronic
1140824845 16:78696190-78696212 TCTTTTTAACTCTCTCTGCCTGG + Intronic
1143451235 17:7038140-7038162 CCTTTTTGACAGGCTCTGGCTGG + Exonic
1146024384 17:29306950-29306972 TATTTTAAAAAATATCTGGCGGG + Intergenic
1146500369 17:33359167-33359189 TCTTTTCAACTTGCTCTGGCTGG - Intronic
1147173183 17:38633763-38633785 TCTTTTAAACAGTTTAAGGAAGG - Intergenic
1149249832 17:54755255-54755277 ACCTTTAAATAATCTCTGGCGGG - Intergenic
1149261251 17:54882250-54882272 ACTGTTAAACAGCCTCTGGCAGG + Intergenic
1149906836 17:60534266-60534288 TCTTTAAACCAGACTCTGGCTGG - Intergenic
1150690464 17:67362376-67362398 TAATTTATACAGGCTCTGGCTGG + Intronic
1150985326 17:70189753-70189775 TTTTTTAAAAAATCTTTGGCAGG - Intergenic
1153470116 18:5434846-5434868 ACTGTAAAACAGCCTCTGGCAGG + Intronic
1153961255 18:10141941-10141963 TCTTTTAGACAATTTGTGGCGGG - Intergenic
1154136819 18:11786955-11786977 TTTTTAAAATAATCTCTGGCTGG + Intronic
1154154111 18:11930403-11930425 ATTTGTAAACAGTCTCTGGGTGG + Intergenic
1155273574 18:24164722-24164744 TTTTTTAAGAAATCTCTGGCGGG - Intronic
1156001828 18:32394111-32394133 TCTTTAAAACAGTCTTGGCCTGG + Intronic
1156402228 18:36749985-36750007 TCTTTTAAAAAGTGTCTGTTCGG + Intronic
1157481366 18:48056188-48056210 TGTTTAAAACAGTCTCTGTATGG - Intronic
1158660692 18:59384876-59384898 TTTTTTAAACAGACCCGGGCTGG - Intergenic
1160762935 19:794937-794959 TTTTTAAGACAGTGTCTGGCCGG - Intergenic
1163408228 19:17136776-17136798 ACTTTGAAACAGTCTCTGGAGGG - Intronic
1164966506 19:32489485-32489507 TCTTTTAAACTGTCTGTGGTAGG - Intergenic
1164975174 19:32567685-32567707 TCCTCTTAACAGTCTCAGGCTGG - Intergenic
1165005882 19:32806352-32806374 TTTTTAAGACAGTCTCTGTCTGG + Intronic
1165777651 19:38414219-38414241 TCTTTAAGACAGTGTCTAGCCGG - Intronic
1167381128 19:49138671-49138693 GATTTTAAAAAGTTTCTGGCTGG + Intronic
925054652 2:847658-847680 ACTGTAAAACAGCCTCTGGCAGG - Intergenic
926435433 2:12833034-12833056 TCTTTTTAAGAGTCACAGGCTGG + Intergenic
928101870 2:28443218-28443240 TTTTTTAGACAGGGTCTGGCTGG + Intergenic
929096260 2:38266006-38266028 TCTTTTAAAAAATCTCTTCCAGG - Intergenic
929215769 2:39410955-39410977 TCTTTTAAACAGTTTCTCAAAGG - Intronic
931193317 2:60026488-60026510 ATTTTGAAACAGTCTCAGGCAGG - Intergenic
932585721 2:73027083-73027105 ACTGTTAAACAGCCTCAGGCAGG + Intronic
934543824 2:95198151-95198173 TCTTTCAAACATCCTTTGGCTGG + Intergenic
934848089 2:97676191-97676213 TCTTTTAAACAGTCTCCCCAGGG - Intergenic
935972403 2:108543111-108543133 TTTTTTAAACAGTCTCTTATGGG - Intronic
938907930 2:135856423-135856445 TTTTTTAAACAGCCTCTCACTGG - Intronic
943292277 2:186089289-186089311 ACTGTAAAACAGTCTCAGGCAGG - Intergenic
943856804 2:192805484-192805506 TCTTTTAAACAGCATATGGTTGG - Intergenic
944774007 2:202943368-202943390 TATTTTAAACACACTGTGGCTGG - Intronic
947107437 2:226682075-226682097 TCCTTTAGACAGTATCTGACTGG - Intergenic
948904911 2:240974979-240975001 TCTTTTGATCAGTGTCTGGGTGG + Intronic
1169369704 20:5019361-5019383 TCTTTGGAACAGTCTGTAGCTGG - Intergenic
1170687979 20:18586586-18586608 TCTTTTAAAAAGTCCACGGCTGG + Intronic
1171391298 20:24803181-24803203 TCTGTTATACAGTGTTTGGCTGG - Intergenic
1174919341 20:54685142-54685164 TCAATCAAACAGTCTCTGTCAGG + Intergenic
1175861929 20:62155104-62155126 TTTTTTAAAAAGTTTCAGGCCGG + Intronic
1176516477 21:7788160-7788182 TGTTTTAAACATTTTTTGGCTGG + Intergenic
1177219015 21:18166532-18166554 TGTTATAAACATTCTCTGGAAGG - Intronic
1178650505 21:34418172-34418194 TGTTTTAAACATTTTTTGGCTGG + Intergenic
1179023860 21:37663477-37663499 TCTTGTAAACAGTATGTAGCTGG - Intronic
1179196926 21:39172732-39172754 ACTGTAAAACAGTCTCAGGCAGG - Intergenic
1179462153 21:41543642-41543664 TCTTTTAAACAGCATATGGCTGG - Intergenic
1183286650 22:36969595-36969617 TCTTTTCAAAAGCCTCTTGCTGG + Intergenic
1183581412 22:38728687-38728709 TCTTGGAATCAGTCTTTGGCTGG + Intronic
1184165771 22:42726754-42726776 TCTCTGGACCAGTCTCTGGCTGG - Intergenic
1184972230 22:48032470-48032492 TCTTTTAAAAAATATTTGGCTGG + Intergenic
949255575 3:2041754-2041776 TTTTTTAATAAGTCTCTGGATGG - Intergenic
950021391 3:9790222-9790244 TCTGTTAAACAGTATGTGACTGG - Intronic
950537235 3:13585981-13586003 ACTATAAAACAGCCTCTGGCAGG + Intronic
955599508 3:60630070-60630092 TGTTTGAACCAGTCTCTGGGAGG - Intronic
956154902 3:66285487-66285509 TCTTTTAAATAATCCCAGGCTGG + Intronic
956329732 3:68092962-68092984 AGTTTTAAACAGTCTCTTTCAGG + Intronic
958761532 3:98314923-98314945 ACTATAAAACAGTCTCAGGCAGG + Intergenic
959430329 3:106246474-106246496 TCTTTTAAAATGTCTTAGGCTGG - Intergenic
959723397 3:109516733-109516755 TATTTTAAAAAATCTCAGGCTGG - Intergenic
959842290 3:110991396-110991418 TCTTTGAATCACTCTCTGTCTGG - Intergenic
960853328 3:122078135-122078157 CCTTTTACTCATTCTCTGGCCGG - Intronic
960961751 3:123075684-123075706 TCTTTTAAAAACTCTCTCTCTGG - Intronic
962567491 3:136677066-136677088 ACTGTAAAACAGTCTCTGGCAGG - Intronic
963882904 3:150547858-150547880 CCTTTTAAACAGTCTTTGCCTGG - Intronic
964099255 3:152968961-152968983 TATTTTAAATACTCTCTGGTAGG + Intergenic
965011988 3:163106233-163106255 TTTTTAAAACAGCCTCAGGCAGG - Intergenic
966586305 3:181629423-181629445 TCTTTCATCCAGGCTCTGGCTGG + Intergenic
969925383 4:10580416-10580438 ACTGTAAAACAGTCTCAGGCAGG + Intronic
973062842 4:45750561-45750583 TTTTTTAATCAGTCATTGGCTGG + Intergenic
973748891 4:53992369-53992391 TCTTCAAAACAGTCTGTGCCAGG + Intronic
974857997 4:67483566-67483588 ACTGTGAAACAGTCTCAGGCAGG + Intronic
975686727 4:76923251-76923273 TACTGTAAACAGCCTCTGGCAGG + Intergenic
977933419 4:102773701-102773723 ACTATAAAACAGTCTCAGGCAGG + Intergenic
978177409 4:105749845-105749867 TCCTTTTAATAGTCTTTGGCAGG - Intronic
978439848 4:108722064-108722086 TCATCTTAACAGTCTTTGGCTGG + Intergenic
981196525 4:141927388-141927410 TCTTTTAAAGATTCTCTCTCTGG - Intergenic
981506818 4:145510318-145510340 CCTTTTAAAAAATCTTTGGCGGG + Intronic
981508032 4:145524763-145524785 TCTTTTTAACAGCTGCTGGCTGG - Intronic
982863747 4:160485270-160485292 TCTTGAAAACAGTCTTTTGCTGG - Intergenic
983521954 4:168718662-168718684 GCATGTAAACAATCTCTGGCAGG - Intronic
984608518 4:181812013-181812035 TCTTAAAAACCGTATCTGGCTGG + Intergenic
984760960 4:183362653-183362675 ACTTTTAAAAAGGCTCTTGCAGG + Intergenic
984995810 4:185428540-185428562 TTTTTTAGACAGTCCCAGGCTGG - Intronic
985299740 4:188475316-188475338 TCTTTTTAAAATTCTCAGGCTGG - Intergenic
987491346 5:18583871-18583893 TCTTTAAAAAAGTCTCTGTGTGG + Intergenic
989437957 5:41436420-41436442 TATTTTCAACAGTATCTGCCTGG - Intronic
990075964 5:51846023-51846045 ACTGTAAAACAGTCTCAGGCAGG - Intergenic
990255001 5:53958649-53958671 TCTTATAAACAGTATATGGTTGG - Intronic
991163351 5:63531742-63531764 TGATTAAAACAGTCTCTGCCAGG + Intergenic
992911268 5:81398219-81398241 TCTTTAAAACTGTCTTTGTCTGG + Intergenic
992990901 5:82282557-82282579 TATTTTAAAAAATTTCTGGCCGG + Intronic
993482614 5:88443163-88443185 ACTTTAAAACAGCCTCAGGCAGG - Intergenic
993943211 5:94086924-94086946 ACTGTAAAACAGCCTCTGGCAGG + Intronic
994335848 5:98565115-98565137 TCTTTTAAAAAGTTTCTTTCTGG + Intergenic
994349584 5:98729187-98729209 ACTTTTAAAAAGTCTCAGCCAGG + Intergenic
994793438 5:104262221-104262243 TTTTTTTAACAGTCTCTTCCAGG + Intergenic
994888330 5:105595701-105595723 TATTTTAAAAAATCTGTGGCCGG - Intergenic
995333632 5:110974440-110974462 ACTTTTAAACTGTCTCTTGAGGG + Intergenic
997499267 5:134358989-134359011 TCTTTTAAAAAATCTGTGCCAGG + Intronic
997973147 5:138420806-138420828 GCTTTTTAACAGTCTGTTGCTGG + Exonic
998538435 5:142955966-142955988 TCTTTAGAACAATCTCTGGAGGG + Intronic
999755723 5:154663039-154663061 TGTTTAAAACAGTCTGGGGCTGG - Intergenic
999927035 5:156390228-156390250 ACATTTAAACAGCCTCAGGCAGG + Intronic
1001471903 5:172020249-172020271 ACTGTAAAACAGTCTCAGGCAGG + Intergenic
1003454309 6:6267100-6267122 TCTTTAAAAGAGTCTTTGGTAGG + Intronic
1005791716 6:29309680-29309702 TATTTTAAAAAGTGTCTGTCAGG + Intergenic
1006913353 6:37578541-37578563 GTTTTTAAAAAATCTCTGGCCGG + Intergenic
1007400996 6:41602225-41602247 TTTTTTAAACAGTATCTGGTGGG - Exonic
1010301053 6:74260113-74260135 TCTTGGAAACATTCTTTGGCAGG + Intergenic
1011310968 6:85979159-85979181 TGTTTTATACAGTATCTCGCAGG - Intergenic
1011483286 6:87816435-87816457 TCTTTATAACAGTATCGGGCTGG - Intergenic
1011657147 6:89562228-89562250 TCCTCTGAACAGTCTCTGCCGGG - Intronic
1012077096 6:94703147-94703169 ACTTTTAAACAGTCTCAGGCAGG - Intergenic
1015506983 6:133998835-133998857 TCCTTTAAACATTTTGTGGCTGG - Intronic
1016034403 6:139371717-139371739 TCTCTGAAACAGTGTCTGACTGG - Intergenic
1016863671 6:148746680-148746702 TCTTGTAAACAGTCACCGGCAGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1017072185 6:150585278-150585300 TCTGTAAAACAGCCTCAGGCAGG + Intergenic
1017628673 6:156374390-156374412 TTTTTTCAACAATCTCTGTCTGG - Intergenic
1017937594 6:159019921-159019943 TTTTTTAAACAGTCTCAATCTGG - Intergenic
1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG + Intronic
1023952216 7:44855634-44855656 ACTGTAAAACAGTCTCAGGCAGG - Intergenic
1026107907 7:67435536-67435558 TCTTGCAAACAGACACTGGCAGG - Intergenic
1026326842 7:69317857-69317879 TCTTTTAGAAGTTCTCTGGCTGG + Intergenic
1027475427 7:78624931-78624953 ACTGTTAAACAGCCTCGGGCAGG + Intronic
1028110962 7:86940781-86940803 TCTTCTATACAGTCTCTGGCTGG + Intronic
1028257156 7:88613267-88613289 TATTTTAAACAATCATTGGCAGG + Intergenic
1028582241 7:92420424-92420446 TCTTTAAAATATTTTCTGGCCGG + Intergenic
1029574613 7:101395288-101395310 TCTTTTAATCAGTCTGTGGTGGG - Intronic
1029805454 7:102991380-102991402 TGCTTTAAACAGTCTCTACCTGG - Intronic
1030328661 7:108249349-108249371 TATATGAAACAGCCTCTGGCTGG - Intronic
1030777863 7:113557695-113557717 TATTTTAAATATTCACTGGCTGG + Intergenic
1031413664 7:121469895-121469917 TCTGTAAAACAGCCTCAGGCAGG - Intergenic
1032606285 7:133357875-133357897 ACTTTGAAACATTCTGTGGCAGG - Intronic
1037148532 8:15605312-15605334 TCTCTTAAACTGTCTCTAACTGG + Intronic
1037222359 8:16539380-16539402 TCTTGTTAACAGTTTCTGCCTGG - Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1038111842 8:24508672-24508694 TCTCTTAAACATTGTCTGTCTGG - Exonic
1038177944 8:25198257-25198279 TCTTATAACTGGTCTCTGGCAGG - Intronic
1039116630 8:34098556-34098578 TCTGTAAAACAGCCTCAGGCAGG + Intergenic
1040483988 8:47853265-47853287 CCTTTTAGACAGTCACTGGCTGG - Intronic
1041503607 8:58568443-58568465 ACTGTAAAACAGTCTCAGGCAGG - Intronic
1044702808 8:94979484-94979506 TCTTTTAAAAAATCTCTTCCTGG + Intronic
1044872850 8:96637473-96637495 TCTTTACAACTGTCTCTGCCTGG + Intergenic
1045969747 8:108066247-108066269 TACTTTAAACACTCTCTGGAAGG - Intronic
1046216321 8:111152389-111152411 TCTCATCAAAAGTCTCTGGCAGG + Intergenic
1048239819 8:132730292-132730314 TATTTTAAAAAGTCTCAGGCTGG + Intronic
1048602825 8:135936591-135936613 ACTGTAAAACAGTCTCAGGCAGG - Intergenic
1048684760 8:136891870-136891892 TTTTTTAAACAATGTCTGGATGG + Intergenic
1049627340 8:143631119-143631141 TTTTTTAAAAGATCTCTGGCCGG - Intergenic
1050780661 9:9330367-9330389 TATTTTAAAAAGTCTGCGGCAGG - Intronic
1050869994 9:10555080-10555102 TCTTTTACAAAGACTCTAGCTGG - Intronic
1051647508 9:19283365-19283387 ACTGTAAAACAGTCTCAGGCAGG - Intronic
1055875333 9:80935234-80935256 TCTATTAAACTGTCTCTACCTGG + Intergenic
1056021781 9:82445514-82445536 TCTTTTAAAAAATCTCTTCCAGG - Intergenic
1056189386 9:84169934-84169956 ACTGTAAAACAGTCTCAGGCAGG - Intergenic
1056377347 9:86027628-86027650 TCTTTTAAACAGCTTTTGGGGGG - Exonic
1056384252 9:86082320-86082342 TATTTTAAAAAGTGTCAGGCTGG - Intronic
1057050613 9:91920957-91920979 TATCCTAAACAGTCTCTGGCTGG - Intronic
1057051701 9:91928681-91928703 TCTTTGAAACAGTCTGTGAGGGG - Intronic
1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG + Intronic
1058640810 9:107083234-107083256 ACTATAAAATAGTCTCTGGCAGG - Intergenic
1059851214 9:118342406-118342428 TCTTTAAAAAAGCCTCTGCCAGG - Intergenic
1060308737 9:122440093-122440115 CCTTTTAAAAAGCCTCTTGCCGG + Intergenic
1060924034 9:127443078-127443100 TCTGTAAAACAGCCTCAGGCGGG - Intronic
1061978643 9:134087068-134087090 TGTTTTAAAAAGTATCTGGCCGG + Intergenic
1062663322 9:137652069-137652091 ACTGTAAAACAGTCTCAGGCAGG + Intronic
1185552386 X:993457-993479 TCTTTTACCCAGTCTCGGGCTGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186144147 X:6608380-6608402 TCTTTTAAACAATATGTGACAGG - Intergenic
1186199162 X:7138719-7138741 TCTTTTGAGCAATGTCTGGCAGG - Intronic
1186286651 X:8051397-8051419 ACTGTAAAACAGCCTCTGGCGGG + Intergenic
1186489867 X:9963105-9963127 TCTTTAAAATAGTAGCTGGCTGG + Intergenic
1186998551 X:15150399-15150421 TCTTTTAAACTTTCTCTTCCAGG + Intergenic
1187539352 X:20176338-20176360 TCTTCTATACAGTTTCTGGAGGG + Exonic
1188285365 X:28320480-28320502 TTTTTTAAAAAGTCTCTTGAGGG - Intergenic
1188599977 X:31950878-31950900 TCTTTTAAACAAACTATGGTTGG + Intronic
1192506565 X:71688889-71688911 TCTTTTATACAGTCTTTGGGTGG + Intergenic
1192520132 X:71792657-71792679 TCTTTTATACAGTCTTTGGGTGG - Intergenic
1192525998 X:71845078-71845100 TCTTTTATACTGTCTTTGGCTGG + Intergenic
1193830467 X:86283072-86283094 TCTTTTAAGAAGTGTCGGGCCGG - Intronic
1194343802 X:92737189-92737211 TCTTTAAAACAGTATATGGGTGG - Intergenic
1194775654 X:97960815-97960837 ACTTTTAACCACTCTCTGTCTGG - Intergenic
1195296482 X:103483132-103483154 ACTGTAAAACAGTCTCAGGCAGG - Intergenic
1196535772 X:116841668-116841690 TCTTTTACACAATCTCTTTCAGG + Intergenic
1198259695 X:134954723-134954745 TCTTTTAACCAGCCACGGGCTGG + Intergenic
1200523392 Y:4240926-4240948 TCTTGTAAACAGTATATGGTTGG + Intergenic
1200652156 Y:5853852-5853874 TCTTTAAAACAGTATATGGGTGG - Intergenic
1201574310 Y:15445616-15445638 TCTTTTGAGCAGTGTCTGGCAGG - Intergenic
1201574436 Y:15446901-15446923 CCTTTTCAGCAGTGTCTGGCAGG - Intergenic