ID: 1023323140

View in Genome Browser
Species Human (GRCh38)
Location 7:39022490-39022512
Sequence AAGACATGGGACACTCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023323135_1023323140 0 Left 1023323135 7:39022467-39022489 CCTGGGTAACAGCTACTCTAGCC 0: 1
1: 0
2: 0
3: 10
4: 178
Right 1023323140 7:39022490-39022512 AAGACATGGGACACTCCTATGGG 0: 1
1: 0
2: 1
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023323140 Original CRISPR AAGACATGGGACACTCCTAT GGG Intronic
906494971 1:46298855-46298877 ATGACAAAGGACATTCCTATTGG - Intronic
910499187 1:87870101-87870123 AAGACATTGCACACTGCAATAGG - Intergenic
918892572 1:190294908-190294930 AAGACATGGGACAGTTCCCTGGG + Intronic
920416792 1:205804359-205804381 AAGACCTGGGACTCTCCTTAGGG + Intronic
1066708029 10:38202385-38202407 AACACATGCAACACTCCTATTGG - Intergenic
1066981477 10:42420183-42420205 AACACATGCAACACTCCTACTGG + Intergenic
1068133841 10:52930360-52930382 AGGATGAGGGACACTCCTATTGG + Intergenic
1071331690 10:84566735-84566757 GGGACATGGGACACTTCTATTGG + Intergenic
1072268341 10:93751790-93751812 AAGACATTGGAGATTACTATGGG - Intergenic
1075991865 10:126844895-126844917 AAGACATGGGACATTCACCTGGG + Intergenic
1076336979 10:129713512-129713534 CAGACATCGGACAATCCTACTGG - Intronic
1082854661 11:57795880-57795902 AAGAGATGGGAAAATCTTATGGG + Intronic
1087958111 11:104315172-104315194 AAGACTTGGGACCCTCATATAGG - Intergenic
1093533006 12:20189260-20189282 CAAACATGGGACACTCTGATTGG - Intergenic
1095644784 12:44530691-44530713 AATACATGGGCCACTCCTCAAGG - Intronic
1102431069 12:112883171-112883193 AAGCCCCTGGACACTCCTATGGG + Intronic
1107379810 13:39845026-39845048 AATGGATGGGACACTCCTACTGG + Intergenic
1109501500 13:63241738-63241760 TAGACATGGGACACTCCAAAGGG - Intergenic
1113163459 13:107410346-107410368 GAGACATGGGACACACCAACAGG - Intronic
1118102441 14:62622071-62622093 AAGACATGGGAGTCTCCAAGTGG + Intergenic
1121628851 14:95408155-95408177 GAGACATGGGGCCCTCCCATGGG + Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1138373182 16:56543477-56543499 ATGAGATGGGACATTCCTTTGGG - Intergenic
1142368349 16:89663149-89663171 GAGAAATGGAACACTTCTATTGG + Intronic
1143909347 17:10234927-10234949 AAGCTCTGGGACACTCCAATGGG - Intergenic
1150181017 17:63121099-63121121 AAGACATGAAGGACTCCTATTGG + Intronic
1155875441 18:31081045-31081067 AATACATGAGATACTCCTTTAGG + Intronic
1156409448 18:36813770-36813792 AAGAGATGGGAAGCCCCTATGGG + Intronic
1162478549 19:10915175-10915197 AAGACATGAGACACAGCTGTGGG - Intronic
1164408370 19:27975414-27975436 AACACATGCAACACTCCTAATGG - Intergenic
1166161759 19:40959359-40959381 AAGACACAGGACACTGCTAGAGG - Intergenic
1167733389 19:51275809-51275831 AAGACATAGGAGACTCCTTGGGG - Intergenic
930770165 2:55122609-55122631 CACACATGGGTCAGTCCTATGGG + Intergenic
932827245 2:74952881-74952903 AAGGGCTGGGACACTCCTACAGG - Intergenic
933695376 2:85213559-85213581 ATGACATGGGACACTTCCAAGGG - Intronic
934230088 2:90171843-90171865 AGGACATGGGAAACTTCCATAGG + Intergenic
935881690 2:107572079-107572101 AAGACCTGAGACAGTCCTGTAGG + Intergenic
937069513 2:119052497-119052519 AAGACCTGGAACTCTCCTCTTGG + Intergenic
939817884 2:146918974-146918996 AACACATAGGAGAATCCTATAGG - Intergenic
941591596 2:167427216-167427238 AAGACAGTGGTTACTCCTATGGG + Intergenic
942529860 2:176897929-176897951 TAGACATTGGAGACTCCAATAGG - Intergenic
942618293 2:177817910-177817932 AACACTTGAGCCACTCCTATGGG + Exonic
943025508 2:182623313-182623335 AAGACATAGTACACTTCTCTAGG + Intergenic
945657862 2:212647216-212647238 AAGACAAAGGAGACTTCTATTGG - Intergenic
947202380 2:227626300-227626322 AAAACATGGTACACCCATATAGG + Intronic
1170297606 20:14845725-14845747 AAGGTATGGGGCACTCCTCTTGG - Intronic
1172881362 20:38201900-38201922 AAGTCAGGGGGCACTCCTAGGGG + Intergenic
1173949158 20:46976744-46976766 AAGACATGGGACATTCCGTGGGG + Intronic
1175601690 20:60279498-60279520 CAAACATTGGACACTCCTAGAGG - Intergenic
1178822266 21:35986158-35986180 AAGACATGAGACAATTATATTGG - Intronic
1182442767 22:30373817-30373839 AAGACATGGGACAGGCCTGCAGG - Intronic
1182781391 22:32871271-32871293 AAGCCATGGGATTCTCCTCTTGG - Intronic
950154251 3:10709698-10709720 AAGACATGGTACAGTGCTAAGGG - Intergenic
950477258 3:13221990-13222012 AGGAAAGGGGACACTCCTCTGGG - Intergenic
950584624 3:13883461-13883483 AGGACTTGGGACACTCCAATAGG + Intergenic
950859685 3:16136986-16137008 AATACATGGGAAACTTTTATGGG + Intergenic
952060301 3:29500535-29500557 AAAACATGGTATAATCCTATGGG - Intronic
953850258 3:46460734-46460756 AAGAAATGAGACACCCATATTGG + Intronic
955076866 3:55621924-55621946 AAGTCAGGGCACACTCCTGTGGG + Intronic
956700799 3:71956845-71956867 AGGACTTGGGACACTCCTTGAGG - Intergenic
958192961 3:90206517-90206539 AAGACATAAGACACTCCTATAGG - Intergenic
958416262 3:93877469-93877491 AAGATATAAGACACTCCTATAGG - Intronic
958578332 3:95982919-95982941 AAGACATTGCTCACTCCTCTAGG + Intergenic
959888142 3:111525779-111525801 AAGACATGGGGCCCTGCGATGGG + Intronic
961906684 3:130269914-130269936 AAGACATTGGAGACTCCAAATGG - Intergenic
963752575 3:149197996-149198018 AAGACATGGGAAATTTCTACAGG + Intronic
964143387 3:153429897-153429919 AATACATGTGACATTCCTACTGG + Intergenic
970905746 4:21213917-21213939 CAGACATGGGACATTCCAAGAGG - Intronic
972831090 4:42814503-42814525 ATGACATGAGACACTACCATGGG + Intergenic
976763363 4:88573644-88573666 AAGGCATGGGAATCTCCTTTGGG - Intronic
976929562 4:90548625-90548647 AGGACCTGGGAAACTCCTATTGG + Intronic
982626718 4:157776556-157776578 AAGACATGGTTCCATCCTATGGG - Intergenic
984174230 4:176396426-176396448 AAAAAATTGGAGACTCCTATAGG - Intergenic
986169699 5:5305599-5305621 AGGACTTGGAACACTCCTCTTGG - Intronic
986485447 5:8231583-8231605 AACAAAGGGGCCACTCCTATGGG - Intergenic
987891144 5:23880410-23880432 TAGACACTGGACACTCCTAAGGG + Intergenic
988368488 5:30334745-30334767 CAGACATGGGATACTCCAAAAGG + Intergenic
988975904 5:36515594-36515616 GAGACATGGGACTCCCCTAATGG + Intergenic
991968668 5:72116952-72116974 AAGAACTGAGACAGTCCTATGGG - Intronic
992112856 5:73512524-73512546 AAGACATGGGACCCTGCTAATGG - Intergenic
994339027 5:98603671-98603693 AAGACATTGGAGACTCCAAAAGG + Intergenic
1002970055 6:2006283-2006305 CAGACATGGGCCACTACTCTTGG - Intronic
1004290153 6:14359362-14359384 AAGAAATGGTACACCTCTATAGG - Intergenic
1007104679 6:39275408-39275430 AAGCCATGGGACTTTCCCATGGG - Intergenic
1008545820 6:52582220-52582242 CAGACATGGGCCACTGCAATTGG + Intergenic
1009299537 6:61997371-61997393 AATACATGTGACAATCCTAGAGG - Intronic
1010684304 6:78833897-78833919 AAGACATGGGACAATTTCATGGG + Intergenic
1013414546 6:109913172-109913194 AAGACATGGGAAGCTCCCAGTGG + Intergenic
1016399107 6:143659042-143659064 AAAAAATGGCACACTTCTATAGG + Intronic
1018308031 6:162478861-162478883 AAAAAATGGGACACTCGTCTAGG + Intronic
1021827143 7:24566432-24566454 AAGGGATGGGGCACTCTTATTGG + Intergenic
1023323140 7:39022490-39022512 AAGACATGGGACACTCCTATGGG + Intronic
1024166939 7:46744035-46744057 AAGAAATGGTACACTTGTATAGG + Intronic
1029983910 7:104903840-104903862 AAGACATGGGATCCACCTAGGGG - Intronic
1030498124 7:110325583-110325605 AAGACAAATGATACTCCTATAGG + Intergenic
1030675896 7:112384993-112385015 AAGCTATGGGGCTCTCCTATGGG - Intergenic
1033658809 7:143390200-143390222 AAGAAATGGGACAAGCCAATAGG + Intronic
1034762387 7:153685232-153685254 AAGACTTGGGGCATTGCTATGGG - Intergenic
1035314267 7:157988456-157988478 AAGACAGGGAACCCTCCTGTGGG - Intronic
1036678640 8:10854482-10854504 AAGATATGGGAAGCTCCTACTGG - Intergenic
1037528457 8:19750471-19750493 AAGAAAACGGACACTGCTATTGG + Intronic
1037710722 8:21353394-21353416 AAGACAGGGCACACTCCGAAGGG + Intergenic
1039119684 8:34131469-34131491 CAGACATGGGAGACTACTAGAGG - Intergenic
1047675418 8:127196613-127196635 AAGTCATGGATCAGTCCTATTGG - Intergenic
1048971347 8:139646603-139646625 AAAACATGGTACAGTCCTTTAGG - Intronic
1056355165 9:85793774-85793796 AAGACATGGGCCAGTACTGTGGG + Intergenic
1056999334 9:91493111-91493133 AAGGGATGGGACCCTCCGATGGG - Intergenic
1057272018 9:93656796-93656818 AAAACAAGGGACAGTCCAATCGG - Intronic
1186331766 X:8542024-8542046 GACACATGGGGCACTCCTTTTGG + Intronic
1189193205 X:39129445-39129467 AAATCATGGGACCCTCCTAAAGG + Intergenic
1190555612 X:51631879-51631901 AGGAAATTGGACATTCCTATGGG - Intergenic
1191061279 X:56299507-56299529 AAGACCTCAGACAATCCTATGGG - Intergenic
1191062651 X:56315986-56316008 AAGACCTCAGACAATCCTATGGG + Intergenic
1191872113 X:65756098-65756120 AAAAAATGGGACACTCATAGGGG - Intergenic
1194311476 X:92313860-92313882 AAGAAATGGTACACTCATATAGG + Intronic
1194729904 X:97440809-97440831 TAGACATGGGAGACTCAAATAGG + Intronic
1196039768 X:111189332-111189354 AAGACATGGAAAAAACCTATGGG - Intronic
1197480544 X:126979840-126979862 TAGACATTGGAGACTCCAATGGG + Intergenic
1198050008 X:132942492-132942514 AAGAGAATGGTCACTCCTATGGG + Intronic
1198175992 X:134154916-134154938 GAGACATGGGACACTGATAGAGG + Intergenic
1199771083 X:150975825-150975847 AAGAGAGGGGACTCTCCAATGGG - Intergenic
1199803098 X:151270745-151270767 AAGTCTTGGGACAACCCTATAGG - Intergenic
1200023190 X:153229205-153229227 AAGAAATGGGAACCTCCCATGGG - Intergenic
1200619748 Y:5428081-5428103 AAGAAATGGTACACTCATATAGG + Intronic
1201430849 Y:13900594-13900616 GACACATGGGGCACTCCTTTTGG - Intergenic