ID: 1023327216

View in Genome Browser
Species Human (GRCh38)
Location 7:39073482-39073504
Sequence AATTCCAAGGAGATGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023327216_1023327223 23 Left 1023327216 7:39073482-39073504 CCCACCCCCATCTCCTTGGAATT 0: 1
1: 0
2: 4
3: 39
4: 392
Right 1023327223 7:39073528-39073550 AGCTCAGAAGCCTTTTGAATTGG 0: 1
1: 0
2: 1
3: 9
4: 181
1023327216_1023327224 28 Left 1023327216 7:39073482-39073504 CCCACCCCCATCTCCTTGGAATT 0: 1
1: 0
2: 4
3: 39
4: 392
Right 1023327224 7:39073533-39073555 AGAAGCCTTTTGAATTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023327216 Original CRISPR AATTCCAAGGAGATGGGGGT GGG (reversed) Intronic
900941177 1:5799568-5799590 GGTTCCCAGGAGCTGGGGGTGGG + Intergenic
902056000 1:13600858-13600880 AATTCCTAAGAGATGGGGTTGGG + Intronic
902761384 1:18583031-18583053 AAGTCCATGGAGATGAGAGTTGG - Intergenic
903365398 1:22802662-22802684 AGGTCCAGGGAGTTGGGGGTGGG - Intronic
905108145 1:35576222-35576244 AGTTACCAGGAGCTGGGGGTTGG + Intronic
905814081 1:40934488-40934510 AGTACAAAGGAGATGGGGGTGGG + Intergenic
905946606 1:41906513-41906535 TTTTGCAAGGGGATGGGGGTAGG + Intronic
906203080 1:43972240-43972262 ACTTCCAGGCAGGTGGGGGTCGG - Exonic
907605880 1:55817115-55817137 AATTCCAAGGAAACAGGAGTTGG + Intergenic
908727672 1:67194256-67194278 TCTTCCCAGGAGATGGGGGTGGG + Intronic
909570590 1:77105437-77105459 AATTCTAGGCAGATAGGGGTGGG - Intronic
910163368 1:84298320-84298342 ACTTCCAGGAAGATGGGGGGAGG - Intergenic
910649671 1:89552314-89552336 TATTCCAAGGAGATTGGGTGTGG - Intronic
911115319 1:94240027-94240049 AAGGCCAAGGAGAGTGGGGTTGG + Intronic
914440273 1:147699602-147699624 GATTTCAAGAAGATGGTGGTAGG - Intergenic
914715360 1:150249942-150249964 ATTTCCAAGGGGCTGGGGGCAGG + Intergenic
916035981 1:160922793-160922815 AATTCAAATGAGATTTGGGTAGG - Intergenic
917380391 1:174399908-174399930 AATTCAAATGAGATTTGGGTAGG + Intronic
917507145 1:175637960-175637982 AATTCACTGGAGATGGGGGTGGG - Intronic
918389598 1:184044732-184044754 GTTGCCAAGGGGATGGGGGTAGG + Intergenic
919228007 1:194733492-194733514 AATGCAAATGAGATGGGAGTTGG - Intergenic
919408977 1:197220478-197220500 AGATCCAAGGAGATGGGAGCAGG + Intergenic
919948341 1:202339736-202339758 AATTCAAAGTATATGGGGGTGGG + Intronic
920366933 1:205453068-205453090 AATTCCACTCACATGGGGGTGGG + Intronic
920797798 1:209157576-209157598 AATGCCAAAGAGCTGGGGCTGGG + Intergenic
921125740 1:212176447-212176469 AATTGCCAGGCCATGGGGGTGGG - Intergenic
921348168 1:214208428-214208450 AACTCACAGGAGGTGGGGGTAGG + Intergenic
922138902 1:222861143-222861165 AATTCCAAAGAGAGGTGAGTCGG - Intergenic
923211921 1:231811257-231811279 ACCTCCAGGGAGAAGGGGGTTGG + Intronic
923412018 1:233720018-233720040 AACTTCAAGGAGATTGTGGTGGG - Intergenic
924116364 1:240751889-240751911 AATTCCCAGGTGTTGAGGGTGGG + Intergenic
924441325 1:244087782-244087804 CGTGCCAAGGAGATGTGGGTGGG - Intergenic
924464800 1:244290358-244290380 AATTCCAGAGTGCTGGGGGTGGG - Intergenic
924568977 1:245220764-245220786 AATTCCAAGAGGATGGGGTGTGG + Intronic
924860397 1:247914881-247914903 AATTGCTAGGAGATGGGAGATGG + Intergenic
1064480136 10:15732179-15732201 AAGTACTTGGAGATGGGGGTGGG - Intergenic
1065023530 10:21519845-21519867 ATTACAAAGGAGATGAGGGTGGG - Intronic
1067152893 10:43751101-43751123 AGTTCCAAGGTGTGGGGGGTGGG - Intergenic
1067544245 10:47181449-47181471 AATCACAAGGATATGGGGGTTGG - Intergenic
1070012542 10:72490675-72490697 AATGGCAAGAGGATGGGGGTTGG + Intronic
1070723916 10:78775174-78775196 AATCCCATGGTGGTGGGGGTGGG - Intergenic
1071306000 10:84299195-84299217 AAATCCAAAGGGATGGGGGCAGG - Intergenic
1073114085 10:101081185-101081207 AATTGCAGGGAGTTTGGGGTAGG - Intergenic
1074075732 10:110122583-110122605 GGTTACAAGGAGGTGGGGGTGGG - Intronic
1074350627 10:112733396-112733418 AAATCCACGGAGACGGGGGCTGG - Intronic
1074861106 10:117511284-117511306 ACTTCCAGGGAGATGGGAGGGGG + Intergenic
1075804569 10:125176838-125176860 AATTGCAAGGAGATGGGGTAGGG + Intergenic
1076552831 10:131294993-131295015 GATTTCCAGGAGGTGGGGGTGGG - Intronic
1077212420 11:1377684-1377706 AGTTGCAAGCAGATGGGGGATGG + Intergenic
1077275658 11:1706299-1706321 AATCCCAGGCAGATGGGGGTGGG + Intergenic
1077810430 11:5631046-5631068 AATAGCAAGGAGATGGCTGTTGG - Intronic
1077907613 11:6546278-6546300 ACTGCCAAGGAGCTGGGGCTGGG - Exonic
1078126122 11:8565293-8565315 ACTTCCAGGGAGATGGGGGTTGG - Intronic
1078733041 11:13993257-13993279 AAGGCCGAGGAGAAGGGGGTGGG + Intronic
1081004480 11:37718000-37718022 AATTCCAAAAACATGGGGCTCGG + Intergenic
1081236307 11:40651335-40651357 AATTAAAAAGAGATGGGGGTGGG + Intronic
1081402823 11:42662454-42662476 ACTTCAAAGGAGATGGGGTGGGG - Intergenic
1081588304 11:44402848-44402870 GAGGCCAAGTAGATGGGGGTGGG - Intergenic
1081742574 11:45450801-45450823 AATTACAAGGAGATGGAAGGGGG - Intergenic
1081845246 11:46236911-46236933 AATTCCACTGAGTTGGGGGTGGG + Intergenic
1081869735 11:46377837-46377859 GATTCGAAGGGGATGGGGGTGGG - Intronic
1082912818 11:58395971-58395993 CACTGAAAGGAGATGGGGGTGGG + Intergenic
1083066815 11:59932186-59932208 AGTTCCAAGTGGAAGGGGGTGGG - Intergenic
1083164365 11:60874522-60874544 AATTCCAAGGAGGTGGGACTTGG - Intronic
1084300114 11:68243985-68244007 AATTATTTGGAGATGGGGGTGGG - Intergenic
1086493248 11:87376820-87376842 AATTCCAAGGCCATGGTGGGTGG + Intergenic
1087372646 11:97304212-97304234 TATTCCAAGGAGTTGGGCGGTGG - Intergenic
1087531323 11:99386101-99386123 AATTCCATGGAGAAGGAGTTAGG + Intronic
1087819094 11:102690881-102690903 AACTCCAGGGAAGTGGGGGTGGG + Intergenic
1088115614 11:106309321-106309343 AATTGCCAGGAGCTGGGGTTAGG - Intergenic
1088322073 11:108564519-108564541 AACTCCAACGAGAGGGGAGTAGG - Intronic
1088430656 11:109755040-109755062 AATACAAAGGAGAAGTGGGTCGG - Intergenic
1089189601 11:116644409-116644431 AGAGCCAAGGAGATGGGCGTGGG + Intergenic
1092079878 12:5707046-5707068 AATTCGAATGAGATTTGGGTGGG - Intronic
1094123763 12:27000898-27000920 CTTTCCAAGCAGATGGGAGTGGG - Intronic
1094340225 12:29402767-29402789 AAGTCCAGAGAGATGGGGTTAGG + Intergenic
1095135714 12:38600107-38600129 AATTCCGATGAGATTTGGGTGGG - Intergenic
1095221515 12:39621463-39621485 AATTTTAATGAGATGGGGGGCGG - Intergenic
1097020924 12:56020527-56020549 GATTCCAAGAATTTGGGGGTGGG - Intronic
1098240566 12:68463132-68463154 AATTCCAAGGAGTTGGCAATTGG - Intergenic
1098696590 12:73565325-73565347 AGTTGCCAGGAGATGGTGGTGGG + Intergenic
1100225585 12:92552630-92552652 AATTCCAGAGAGTTGGAGGTTGG - Intergenic
1100850418 12:98704354-98704376 AGTTCCAAGAAGATGGGTATGGG + Intronic
1100898674 12:99214342-99214364 AATTCAAATGAGATTTGGGTGGG - Intronic
1102681395 12:114692840-114692862 AATTGCAAGGAGATGGCTCTCGG + Intergenic
1105234370 13:18533567-18533589 AAATCCCAGGAAATGGGGGGAGG - Intergenic
1105506248 13:21012787-21012809 ATTTCCTAGGAGGTGGGGGGGGG - Intronic
1105594842 13:21827694-21827716 AATCCCAAGGAGGTGTGGGAAGG - Intergenic
1105618340 13:22041689-22041711 AATTCCAAGTAGATAGATGTTGG + Intergenic
1106065586 13:26345191-26345213 CATTCCAAGGTACTGGGGGTAGG + Intronic
1106396793 13:29388102-29388124 AATTCCATGGAGACTGGAGTTGG - Intronic
1106765559 13:32909855-32909877 AATACCAAAGAGATGTGGGGAGG + Intergenic
1106998914 13:35521710-35521732 AATTCCAAGGAGAGGGAATTTGG + Intronic
1107323761 13:39217490-39217512 ATTGTCATGGAGATGGGGGTTGG - Intergenic
1108623065 13:52202841-52202863 GATGGCAAGGAGATGGGGGAAGG - Intergenic
1109233958 13:59792832-59792854 AATGCCAAGAAGATGGAGTTTGG - Intronic
1109391924 13:61705043-61705065 AATTCAAATGAGATTTGGGTAGG - Intergenic
1109418720 13:62080400-62080422 AATTCAGAGGAGATTTGGGTGGG - Intergenic
1110167199 13:72457520-72457542 AGAACCAGGGAGATGGGGGTGGG - Intergenic
1111869801 13:93817120-93817142 ACTTCCAAGGTGATGGAGCTGGG - Intronic
1111923609 13:94439440-94439462 AATGCCATGGAGGTGGGAGTTGG - Intronic
1112345869 13:98589049-98589071 AATTCCAAGCACATGGGTTTTGG - Intergenic
1112432300 13:99360701-99360723 ACTTCCAAGAGGATGGGGCTGGG - Intronic
1112646152 13:101334344-101334366 GAGTCACAGGAGATGGGGGTAGG + Intronic
1112946193 13:104929978-104930000 AATTCCCAGGTGATGTGGGAGGG + Intergenic
1113412281 13:110100901-110100923 ATCGTCAAGGAGATGGGGGTGGG - Intergenic
1113710497 13:112461465-112461487 AAATCCCTGGAGGTGGGGGTGGG - Intergenic
1114686476 14:24536809-24536831 AAATCCAAGAAAATGGGGGAGGG - Intergenic
1115654799 14:35432958-35432980 AATTCCAAGAAAATAGGGCTTGG + Intergenic
1115969821 14:38932661-38932683 AAGGCCAATGAGATGGGGGCAGG - Intergenic
1116645760 14:47526918-47526940 AACTCAAAGCAGATGGGGCTTGG - Intronic
1116676670 14:47914925-47914947 AATTCAAATGAGATTTGGGTGGG - Intergenic
1117163515 14:53011781-53011803 AATTCAATGGAGATGGGGGAGGG + Intergenic
1117531876 14:56667513-56667535 AAATACAAGCAGATGGGGGGAGG + Intronic
1120115285 14:80609469-80609491 AATACCCAGTGGATGGGGGTGGG - Intronic
1120857576 14:89226094-89226116 AATTCCCAAGTGATGGGGGCGGG + Intronic
1121738671 14:96236328-96236350 AATTCCAGGCAGGTGGGGATGGG - Intronic
1121850429 14:97217486-97217508 AATTCCACAGGGATGAGGGTTGG + Intergenic
1122162472 14:99793910-99793932 ATTTCCAAACAGATGTGGGTCGG - Intronic
1122581285 14:102773292-102773314 AATGCAGAGGAAATGGGGGTGGG - Intergenic
1123151254 14:106184081-106184103 AATTCCTTGAAGAAGGGGGTTGG + Intergenic
1123818626 15:24004022-24004044 ACTGCCATGGAGATGGGTGTAGG + Intergenic
1124582694 15:30974597-30974619 AATTCCTAGAACTTGGGGGTTGG + Intronic
1125726390 15:41870367-41870389 AATGCCGAGGAGATGAGGGATGG + Intronic
1126687562 15:51261757-51261779 AATTCCAAGGAGAGAAGTGTGGG + Intronic
1127973254 15:63978716-63978738 ACTTGGAAGGAGATGGGGGGTGG - Intronic
1128510871 15:68313318-68313340 CATGCCAAGGGGGTGGGGGTGGG + Intronic
1128528687 15:68430053-68430075 GCTTGCAAGGAGCTGGGGGTGGG - Intronic
1129267940 15:74404006-74404028 GACGCCGAGGAGATGGGGGTCGG + Intergenic
1130659384 15:85818158-85818180 AATCCCAAGGAGCTTGGTGTGGG - Intergenic
1131023369 15:89118961-89118983 AGGTCCAAGGAGATGGGGCTGGG - Intronic
1131432140 15:92395463-92395485 AATTCCAGGGAGATGGGCAGGGG - Intronic
1132340914 15:101078170-101078192 CAGTGCAGGGAGATGGGGGTGGG - Intronic
1133008570 16:2897822-2897844 AGTTCCAGGGAGATGGGGCAGGG + Intronic
1133203014 16:4216120-4216142 AATTCCCAGGAATTGGAGGTGGG - Intronic
1133518217 16:6530756-6530778 AAGTCTCATGAGATGGGGGTGGG - Intronic
1133530793 16:6653230-6653252 TAAACCAAGGAGAAGGGGGTGGG - Intronic
1133928043 16:10209720-10209742 AAATCCAGGGAGATGGTGGGGGG + Intergenic
1134661886 16:15990481-15990503 AGTTGCAAGGAGCTGGTGGTGGG - Intronic
1135033236 16:19055806-19055828 AATACCTAGGTGACGGGGGTAGG - Intronic
1135086822 16:19481808-19481830 ACTTCCAATGTGATGGAGGTGGG + Intronic
1135353363 16:21749228-21749250 CATTAAACGGAGATGGGGGTCGG + Intronic
1136028018 16:27482319-27482341 AATGCCAAGCAGTTGAGGGTAGG - Intronic
1136663005 16:31781495-31781517 AATTCCCAGGAGTTGTGGGAGGG + Intronic
1137592139 16:49700266-49700288 ATTTCCAAGTAGCTTGGGGTTGG - Intronic
1137860913 16:51845863-51845885 AATGCCAGGGGGTTGGGGGTGGG + Intergenic
1139844379 16:69909229-69909251 AAGTTCAAGGAGAAGGGGTTTGG + Intronic
1139851365 16:69952883-69952905 GTTTCCCAGGAGGTGGGGGTGGG + Intronic
1139880342 16:70175795-70175817 GTTTCCCAGGAGGTGGGGGTGGG + Intronic
1140372168 16:74419722-74419744 GTTTCCCAGGAGGTGGGGGTGGG - Intronic
1140398966 16:74654498-74654520 AATCCCAAGGAGAGGGAGGGAGG - Intronic
1140962636 16:79931251-79931273 TATTCCAAGATGATGTGGGTAGG - Intergenic
1141072271 16:80968527-80968549 CATTCCTAGAAGATGGGGGGAGG - Exonic
1142157678 16:88540029-88540051 ACCTCCAAGGAGGAGGGGGTTGG - Intergenic
1143344563 17:6240319-6240341 AATTCCCAGGAGAGGTTGGTTGG - Intergenic
1143564972 17:7715773-7715795 ATCTCCACGGAGAGGGGGGTGGG - Intergenic
1144762111 17:17712969-17712991 AATTGCCAGGGGCTGGGGGTGGG + Intronic
1148835115 17:50461846-50461868 AACTCCAAGGAGAGCGTGGTTGG + Intronic
1149515876 17:57280561-57280583 AATCTCACGGAGGTGGGGGTTGG - Intronic
1150574053 17:66414158-66414180 AATTCCTATGAGATGTGGGTGGG - Intronic
1151312893 17:73305046-73305068 AATTCCCAGGAGGTGAGGGAAGG - Intronic
1151516196 17:74597649-74597671 AATTCAAATGAGATTTGGGTGGG + Intergenic
1151935469 17:77258304-77258326 GATACCAAGGCGATGGGGCTTGG - Intergenic
1152257173 17:79246849-79246871 AGTGCCAATGGGATGGGGGTGGG + Intronic
1152529192 17:80907065-80907087 AAGTCCACGGAGATGGAGGCGGG - Intronic
1153513060 18:5876580-5876602 AATTACCAGGAGTTGGGGGAAGG - Intergenic
1153997818 18:10456319-10456341 AATTCTAAGCAGATGGGCCTAGG - Intronic
1157134903 18:45044664-45044686 ATTTCCAAGGAGATGAAGCTGGG - Intronic
1157187809 18:45555229-45555251 AATTCCAAGGGGAGGGGAGAAGG + Intronic
1157345688 18:46829798-46829820 AATTCCAAGAAGATGGTTCTTGG - Exonic
1157445156 18:47738876-47738898 ACTTCCAAGGTGATGGGACTAGG - Intergenic
1159056947 18:63475656-63475678 AATACCCAGGACATGGGGGAGGG + Intergenic
1159549217 18:69877423-69877445 AAATCCAAGAGGATGGGGTTTGG - Intronic
1160359331 18:78257925-78257947 AATTCAAATGAGATTTGGGTGGG + Intergenic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1160753882 19:747846-747868 ACTTCCAATGAGAGGGGGCTGGG - Exonic
1161089546 19:2353093-2353115 ACGTCCGAGGAGATGGGGGCTGG + Exonic
1162384805 19:10354407-10354429 GATTCTCAGGAGATGTGGGTGGG - Intronic
1162592497 19:11601610-11601632 AATTCCAGGATTATGGGGGTGGG + Intronic
1163503087 19:17687708-17687730 AATTCGAAGGAGAGTGCGGTGGG - Intronic
1163847194 19:19644246-19644268 AATTCCACTGTGCTGGGGGTGGG - Intergenic
1164901470 19:31929564-31929586 AATCCCAAGGCGCTGGGAGTAGG - Intergenic
1166287075 19:41837785-41837807 AATTCCAAGGAGGAAGGGGAAGG - Intronic
1166517683 19:43459793-43459815 GATTGGAAGGAGATGGAGGTGGG + Intergenic
1166682158 19:44775683-44775705 AATTCCTACGAGATGGGGGTGGG + Intergenic
1167575240 19:50314786-50314808 AGGTCAAAGGAGCTGGGGGTGGG - Intronic
1167663600 19:50810842-50810864 ATTTGGAAGGAGATGGGGTTGGG + Intergenic
1167678140 19:50901572-50901594 AATTGCCAGGAGCTGGGGCTCGG - Intergenic
925124147 2:1441901-1441923 AATTCAAATGAGATTTGGGTGGG - Intronic
926062647 2:9813779-9813801 AACTCCCAGGGGATGGGGTTGGG + Intergenic
926134561 2:10327172-10327194 AAATCCCAGGAGTTGGGGGAAGG - Intronic
926506409 2:13721621-13721643 AATTCCCAGGTGTTGTGGGTCGG - Intergenic
926596869 2:14800201-14800223 AATTCAAATGAGATTTGGGTGGG - Intergenic
927145319 2:20161622-20161644 AATTCCAGTGAGATGGTTGTTGG + Intergenic
927640928 2:24844837-24844859 AATTCAAATGAGATTTGGGTGGG - Intronic
930022100 2:47007750-47007772 CATGCCCAGCAGATGGGGGTAGG - Intronic
930253307 2:49060515-49060537 CATTCCAGGGAAATGGGGCTTGG + Intronic
930476764 2:51891831-51891853 TATCCCAGGGAGATGGGAGTTGG - Intergenic
930494479 2:52124300-52124322 AAAGACAAGGAGATGGGGGAAGG - Intergenic
932003020 2:67901891-67901913 ATTTGCAAGGGGATGAGGGTAGG + Intergenic
932138689 2:69255863-69255885 TATTCCCAGTAGCTGGGGGTGGG - Intergenic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932493780 2:72136791-72136813 AATCCTAAGGACATGAGGGTTGG - Intronic
934942095 2:98510131-98510153 AATTCCCAGGGTATGGGAGTTGG + Intronic
936780733 2:116029580-116029602 AGTTGCCAGGAGTTGGGGGTGGG - Intergenic
937032523 2:118752704-118752726 AATTCCAAGTAGCTGGGAGTAGG + Intergenic
937221179 2:120344148-120344170 AATTCCCTGGGGGTGGGGGTGGG + Intergenic
937375602 2:121333808-121333830 AAATCCTAGGAGATGGGAATTGG - Intergenic
938515434 2:132001085-132001107 AAATCCCAGGAAATGGGGGCAGG + Intergenic
938727745 2:134121752-134121774 CATTCTAAGGAGATGCGAGTGGG + Intronic
939176249 2:138751031-138751053 AATGAGAAAGAGATGGGGGTGGG - Intronic
939611165 2:144312648-144312670 AATTACAATGAGATTTGGGTGGG - Intronic
939705795 2:145451334-145451356 AATTGCCAGGAGATTGGGCTGGG + Intergenic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
940173182 2:150850353-150850375 AATCCTAGGCAGATGGGGGTGGG - Intergenic
940523080 2:154776356-154776378 ACTTCCTAGCAGATGGGGGTTGG - Intronic
941388075 2:164877614-164877636 GATTCCAAGGAGAGAGGGGAAGG + Intergenic
941543482 2:166816036-166816058 GAATCCAAGGAGAGGGAGGTGGG + Intergenic
941690990 2:168500589-168500611 AATTACAAGGAGGTGGGAGAAGG + Intronic
941978411 2:171430699-171430721 AATCCTAGGCAGATGGGGGTGGG + Intronic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
944101527 2:196032297-196032319 AATTCAAATGAGATTTGGGTGGG + Intronic
944402564 2:199345080-199345102 AAATGCCAGGAGATGGGGGCAGG - Intronic
944680552 2:202073135-202073157 CATTCCCCGGGGATGGGGGTGGG - Intergenic
945678970 2:212889916-212889938 TATTCCAAGGATGTGGGGGTAGG - Intergenic
946094424 2:217260580-217260602 AATACCAAGAGGATGTGGGTGGG - Intergenic
946220084 2:218218020-218218042 CTTTTAAAGGAGATGGGGGTGGG - Intronic
946253887 2:218429739-218429761 AATTCCAGGGGGCTTGGGGTGGG + Intronic
946353960 2:219173251-219173273 AAAGCCCAGGAGATGGGGTTGGG - Intronic
946897993 2:224344644-224344666 AATACCAAGGGGATGGTGCTAGG + Intergenic
947070824 2:226286623-226286645 ACTTCCTGGGAGATGGGAGTAGG - Intergenic
947992613 2:234498472-234498494 AATTCCAAGGATAGGGGTGGTGG - Intergenic
948532240 2:238616668-238616690 CATTCCAGGAAGAAGGGGGTGGG - Intergenic
1168934929 20:1656804-1656826 AATTCTAAGGCGCTGGGGATTGG - Intronic
1169649981 20:7856205-7856227 AATTCCAAGAAAATGGGGATGGG - Intergenic
1169804871 20:9549234-9549256 CACTCCAAGCAGATGGTGGTGGG + Intronic
1169931999 20:10843591-10843613 AATTCCCAGGATAGGAGGGTGGG - Intergenic
1171151251 20:22828122-22828144 CATTCCAAGGAGATGAGGGAGGG - Intergenic
1171462207 20:25304446-25304468 ACTTCCAATGAGCTGAGGGTGGG + Intronic
1171571598 20:26256346-26256368 AATTCAAGTGAGATGTGGGTAGG - Intergenic
1174969712 20:55260968-55260990 AATTCCAAAGACATGCTGGTTGG - Intergenic
1175330646 20:58161685-58161707 ATTTCCAAGGAGTGGGGGGTTGG + Intergenic
1176692604 21:9934204-9934226 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1176778357 21:13161850-13161872 AAATCCCAGGAAATGGGGGGAGG - Intergenic
1177751393 21:25288700-25288722 AAGTCCAAGTGGAAGGGGGTTGG + Intergenic
1177975980 21:27850857-27850879 AAATCCCAGGAAATGGGGGGAGG - Intergenic
1178009716 21:28270192-28270214 AATTCAAATGAGATTTGGGTCGG + Intergenic
1178369614 21:32016642-32016664 CCTTCTAAGGAGGTGGGGGTGGG + Intronic
1178432737 21:32530855-32530877 AATTCCCATGTGATGGGGGAGGG + Intergenic
1179000671 21:37455100-37455122 AATTCTTGGGAGATGGGGGAGGG + Intronic
1179321070 21:40291596-40291618 AGTTCCCAAGAGTTGGGGGTAGG - Intronic
1179479817 21:41670022-41670044 CATTCCAAGGCCCTGGGGGTTGG + Intergenic
1181044426 22:20207828-20207850 AGGTCCCAGGAGCTGGGGGTGGG + Intergenic
1181117746 22:20643881-20643903 AAATCCAGGGAGACTGGGGTGGG + Intergenic
1182881499 22:33737803-33737825 GATTCTAGGGAGATGGGGCTGGG + Intronic
1183519958 22:38291233-38291255 ACTAACAAGGACATGGGGGTGGG - Exonic
1184107548 22:42376946-42376968 AATTGAAAGGAGGTGGGGGAGGG + Intergenic
1184350345 22:43939418-43939440 AATTTAAAGGAGCTGGGAGTGGG + Intronic
1185296566 22:50057858-50057880 AGTTCCCAGAAGATGGGGGAAGG + Intergenic
949729027 3:7085796-7085818 TATTCCAAGAGGATGGGGGTAGG - Intronic
950065507 3:10108397-10108419 CATTCCAATGAGGTGGGGGCGGG - Intergenic
950340426 3:12239467-12239489 AAAGCCAAGGAGAAGGGTGTGGG - Intergenic
952869363 3:37884853-37884875 ATTTGCCAGGAGGTGGGGGTGGG + Intronic
952932016 3:38367825-38367847 AATGCCAAGGAGATAGAGGAAGG + Intronic
953679252 3:45027217-45027239 GAGTCCAAGGGGATGAGGGTGGG + Intronic
954009090 3:47619128-47619150 AGTTCCCAGGAGATGGGGAGAGG - Intronic
954224511 3:49173409-49173431 CATTTCTAAGAGATGGGGGTGGG + Intronic
954524984 3:51261930-51261952 TATCCCAGGGAGATGGGAGTTGG - Intronic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
955142680 3:56285208-56285230 AGTTTCAAGCAGATGGGGCTAGG + Intronic
955419325 3:58721138-58721160 AATTCCAAGATGCTGGGAGTGGG + Intronic
955981133 3:64528871-64528893 ACTTCCAGGAAAATGGGGGTGGG - Intronic
957258971 3:77875802-77875824 AATTCAAATGAGATTTGGGTGGG + Intergenic
959735947 3:109658797-109658819 AATTCCCAGGGTCTGGGGGTTGG + Intergenic
961609375 3:128124255-128124277 AATTCCACGGAAACGGTGGTGGG - Intronic
962338253 3:134557897-134557919 AATTCCAAGAAGGTGGAGGAAGG - Intronic
963019500 3:140859203-140859225 AACCCCAAGGTGATGGAGGTGGG + Intergenic
963037609 3:141046077-141046099 CATTCCAAGGAAATGGAGCTGGG + Intergenic
963115869 3:141728549-141728571 AACTCCCAGGAGATGGAGGTGGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966402842 3:179563981-179564003 AATTCCTAGCCGATGGGGGTGGG + Intronic
966893155 3:184422708-184422730 AATTCCATAGAGCTGGGTGTTGG + Intronic
967836037 3:193963623-193963645 AGTTTCAAGGAGATAGGGGAAGG - Intergenic
967951913 3:194847777-194847799 AGTTCCATGGAGAAGGGGGAAGG + Intergenic
968073949 3:195805643-195805665 AATTAGCAGGAGATGGTGGTGGG - Intronic
968534006 4:1112788-1112810 GATACCGAGGAGATGGGGGGAGG - Intronic
969499850 4:7546094-7546116 AATCCCAAGGTGATGGGATTTGG - Intronic
969528003 4:7713836-7713858 TGTTGCAGGGAGATGGGGGTAGG + Intronic
972497254 4:39645492-39645514 AATTCCAAGGGGAGGGTGGGAGG - Intergenic
973854469 4:54996875-54996897 AATTCAAATGAGATTTGGGTGGG + Intergenic
974095908 4:57363709-57363731 ATTTTAAAGGAGATAGGGGTGGG - Intergenic
974754194 4:66182717-66182739 AATCCCAAGGTGATGGCAGTGGG + Intergenic
974916702 4:68186641-68186663 AAAGGCAAGGAGATGGGGGCAGG + Intergenic
976205229 4:82617735-82617757 AACTCTAAGGATTTGGGGGTGGG + Intergenic
976813391 4:89120692-89120714 AATTCCAAAGGGCGGGGGGTGGG - Intergenic
976844003 4:89465715-89465737 GATTGCAAGGAGCTGGGGGAGGG + Intergenic
977233379 4:94478408-94478430 AACTGCATGGGGATGGGGGTTGG + Intronic
977460231 4:97315955-97315977 AATTCCAAGGAGATGATGAGAGG - Intronic
978166645 4:105616585-105616607 AATCCCCAGGTGATGGGGGAGGG - Intronic
979110647 4:116750565-116750587 AATTACTAACAGATGGGGGTTGG - Intergenic
979852975 4:125595999-125596021 CATTCCAGAAAGATGGGGGTGGG + Intergenic
980109635 4:128622780-128622802 AATGCCAAGTCGACGGGGGTTGG + Intergenic
980365188 4:131794416-131794438 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
982618797 4:157677773-157677795 AATTCCAATGAGATTTGGGTAGG + Intergenic
982860784 4:160446363-160446385 GATTTCCAGGAGATGGGGGTTGG - Intergenic
983650054 4:170028118-170028140 AATTTAAAAGAGATGGGGGAGGG - Intronic
986424801 5:7620587-7620609 AATGCTAAGGAGATGGGATTGGG + Intronic
986624788 5:9713470-9713492 AATTCAAAGCAGTGGGGGGTGGG - Intergenic
986768468 5:10949701-10949723 AATCCCAAGGTGATGGTGTTAGG - Intergenic
988621684 5:32829855-32829877 AATTCCCAGGAGCTGTGGGAGGG - Intergenic
989422953 5:41261563-41261585 AATAAGCAGGAGATGGGGGTAGG - Intergenic
990754985 5:59058627-59058649 ATTTCCAAGGGGAGGGGAGTTGG - Intronic
991084759 5:62638600-62638622 ACTTCCAAGGTGATGAGGGTGGG + Intergenic
991269967 5:64768276-64768298 AATCCCAAGCAGCTGGGGCTTGG + Intronic
991947381 5:71912555-71912577 GATTGCCAGGAGCTGGGGGTAGG + Intergenic
992472291 5:77069993-77070015 AATACCAAGGACATGGTTGTAGG + Intergenic
992612263 5:78517760-78517782 AATTCAAATGAGATTTGGGTGGG + Intronic
992766549 5:80006230-80006252 AATTCAAATGAGATTTGGGTGGG - Intronic
993002099 5:82391599-82391621 AAAACCAAGGACATAGGGGTAGG + Intergenic
993071453 5:83169032-83169054 AATTCAAGGGAGCTGTGGGTGGG + Intronic
993755121 5:91719744-91719766 TATTCCAAGGATTTGGGGATTGG + Intergenic
994901323 5:105774090-105774112 CATTCAAAGGAGATGGGAATGGG - Intergenic
995159472 5:108961465-108961487 AATTCCAAAGTGTTGGGGGTTGG - Intronic
995742245 5:115367154-115367176 GATTCCAAGGGGCTGGGGGAAGG - Intergenic
995901391 5:117071878-117071900 AATTCCAAGGACATGCAGGTAGG - Intergenic
996607818 5:125344587-125344609 AATTCCAAGGAGCAGGAGCTTGG + Intergenic
997206316 5:132052315-132052337 AGTTCCAAGGAGGTGGAGGAGGG + Intergenic
999376099 5:151087351-151087373 AATTCCAGGGAGTTGGGGTTGGG + Intronic
1000832932 5:166126620-166126642 AATTCTATGGAGATGTGGCTAGG + Intergenic
1001215890 5:169855402-169855424 AGTGGCAAGGAGATGGGGTTGGG + Intronic
1001315691 5:170639710-170639732 AATTACAAAGTGATGGGGGCAGG - Intronic
1001657080 5:173359401-173359423 ACTTCCAGGGAGATAGGGCTGGG - Intergenic
1004402971 6:15305729-15305751 TGCTCCAAAGAGATGGGGGTGGG - Intronic
1007049574 6:38813402-38813424 AAATACAAGCAGATGGGGGGTGG - Intronic
1010002843 6:70965442-70965464 AATCCCCATGAGTTGGGGGTGGG - Intergenic
1011742925 6:90381248-90381270 GATTCCATTGATATGGGGGTAGG - Intergenic
1011967321 6:93175082-93175104 AAAACCTAGGAGATGGAGGTGGG - Intergenic
1014768019 6:125429377-125429399 AATTTCATGGGGGTGGGGGTCGG + Intergenic
1014815530 6:125931746-125931768 AATTCCAATGAGATGTTGGTGGG - Exonic
1015273155 6:131357849-131357871 AAATCCAAAAAGATGGTGGTAGG + Intergenic
1015460138 6:133481067-133481089 ACTTCCTAGGAGGTGGGGCTGGG + Intronic
1015984597 6:138872545-138872567 AATTTCAAAGAGATGGTGGCTGG - Intronic
1016552492 6:145297184-145297206 AATTCCAAGAAAATGTGGTTTGG - Intergenic
1017047076 6:150356816-150356838 AATGCCAAATAGATGGGGGCGGG - Intergenic
1017316931 6:153042285-153042307 AATTCAAATGAGATTTGGGTGGG - Intronic
1018705051 6:166457969-166457991 AAGTCCAGGGAGCTGGTGGTTGG - Intronic
1019790876 7:3013131-3013153 AATCCCAAGGAGATGGTATTAGG + Intronic
1021775727 7:24053488-24053510 ATTTGGAAGGATATGGGGGTTGG + Intergenic
1022547037 7:31199509-31199531 AATTCCATTGAGATGGTGGCTGG + Intergenic
1023327216 7:39073482-39073504 AATTCCAAGGAGATGGGGGTGGG - Intronic
1023417903 7:39949929-39949951 ATTTCCGGGGAGATGGGGGCAGG - Intergenic
1024280867 7:47718478-47718500 CATTGCCAGGAGGTGGGGGTAGG + Intronic
1024896920 7:54270868-54270890 ACTGCTAAGGAGATGTGGGTGGG + Intergenic
1026079442 7:67204838-67204860 AATCCCAGGGAGGTGGAGGTGGG - Intronic
1026122472 7:67549928-67549950 AACTCCAAGGTGATGGCGTTAGG - Intergenic
1026517868 7:71088227-71088249 AATTCTAATGAGATTTGGGTGGG - Intergenic
1026617494 7:71918774-71918796 AATTCCAAGGAGCTGGGGGCTGG - Intronic
1026857888 7:73767003-73767025 AGTTTCAAGGAGGTGGGTGTGGG - Intergenic
1027837798 7:83267671-83267693 AAATCGAAGGAAATGTGGGTAGG - Intergenic
1028990868 7:97047367-97047389 GATTCCTAGGAGTTGGGGGAAGG + Intergenic
1030810903 7:113971023-113971045 AATTACAATGAGATTTGGGTGGG + Intronic
1031936510 7:127740670-127740692 ATTTCCAAGGGGGTGGGGGGTGG + Intronic
1032099884 7:128965907-128965929 AATTGCCAGGAGATGGGGAGAGG + Intronic
1032919539 7:136529409-136529431 ATAGCCAAGGATATGGGGGTGGG + Intergenic
1033441403 7:141382973-141382995 ATTTCCAAGGAGATTGGGGTGGG - Intronic
1033686565 7:143646207-143646229 ACTTTCAAGAAGATGGGGATTGG - Intronic
1033689171 7:143721100-143721122 ACTTTCAAGAAGATGGGGATTGG + Intronic
1033698047 7:143811408-143811430 ACTTTCAAGAAGATGGGGATTGG + Intergenic
1034654748 7:152720541-152720563 AATTCCAAGGAGGTGGGCTTGGG - Intergenic
1035079351 7:156203262-156203284 AATTCTATGGGGCTGGGGGTGGG - Intergenic
1037203963 8:16291598-16291620 AACTCCAAGGAGATGGACATGGG + Intronic
1037290039 8:17340788-17340810 AATTCCATGGAGAAGGGAGTAGG - Intronic
1037895795 8:22653876-22653898 AATTCTTTGGAGGTGGGGGTTGG + Intronic
1037933543 8:22898973-22898995 AGTTCCAAGGAGGTGTGGCTTGG + Intronic
1038568325 8:28638154-28638176 AATTCCAAGAAGATGGGTACAGG - Intronic
1039187458 8:34933396-34933418 ATTTCCTAGGAGAGGGTGGTTGG - Intergenic
1039426188 8:37488168-37488190 AATTCCCAGGTGTTGTGGGTGGG + Intergenic
1041710500 8:60889935-60889957 GATTCCAAAGACGTGGGGGTTGG - Intergenic
1042332932 8:67600341-67600363 AGTTACTAGGAGCTGGGGGTGGG + Intronic
1042390176 8:68225392-68225414 ATTTCCATGGTGATGAGGGTAGG + Intronic
1042767962 8:72347102-72347124 AATTGCAAAAAGATGGGGCTGGG - Intergenic
1042891435 8:73616099-73616121 AATTCCTGGGTGTTGGGGGTTGG - Intronic
1043241417 8:77939538-77939560 AATTCAAATGAGATTTGGGTGGG + Intergenic
1043853661 8:85241509-85241531 AATTGCCAGGGCATGGGGGTGGG + Intronic
1045405631 8:101863952-101863974 AATTCCAAGGGGATGGGGCCTGG + Intronic
1045687896 8:104730050-104730072 AGTTGCCAGGAGATGGAGGTTGG + Intronic
1045692055 8:104769904-104769926 AACTCCCAGAAGATGGGGGGTGG + Intronic
1047179517 8:122573760-122573782 AATTGAAAGGAGATGGAGGTGGG - Intergenic
1047702012 8:127458103-127458125 AATGAAAAGGAGTTGGGGGTGGG + Intergenic
1049557219 8:143289179-143289201 GACTCCAGGGACATGGGGGTGGG - Intergenic
1050674407 9:8036087-8036109 AATTCAAATGAGATTTGGGTGGG + Intergenic
1051127877 9:13824646-13824668 AATGGCAACAAGATGGGGGTTGG - Intergenic
1051211326 9:14747856-14747878 AATTCCAATGATTTGGGCGTGGG - Intronic
1051597336 9:18838319-18838341 AATTCAAATGAGATTTGGGTGGG + Intronic
1052084736 9:24250309-24250331 AATTCAGAGGAGATTTGGGTGGG + Intergenic
1052122234 9:24731555-24731577 AATTCTAGGCAGATGGGGGTGGG - Intergenic
1052701193 9:31940265-31940287 AATTCAAATGAGATGTGGGTTGG - Intergenic
1053202515 9:36162388-36162410 AACACCAAGAAGATGGGCGTGGG + Exonic
1053223694 9:36333118-36333140 CATTCCAAAGAATTGGGGGTAGG - Intergenic
1053629546 9:39920269-39920291 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1053776220 9:41543278-41543300 AACTCAAAGCAGGTGGGGGTGGG + Intergenic
1054214341 9:62330433-62330455 AACTCAAAGCAGGTGGGGGTGGG + Intergenic
1054365512 9:64335212-64335234 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1054673143 9:67824925-67824947 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1054728987 9:68681566-68681588 AAAGTCAAGGACATGGGGGTGGG + Intergenic
1054855861 9:69898885-69898907 AATTAGAAAGACATGGGGGTGGG - Intronic
1056546225 9:87616162-87616184 ATTTCCATGAAGTTGGGGGTGGG + Intronic
1056805863 9:89728462-89728484 AATTCCAATTAGAGGGTGGTTGG + Intergenic
1057243150 9:93430597-93430619 AATTCAAAGCACATGGGGATGGG + Intergenic
1057327337 9:94077463-94077485 AAATCCAAAGAGAGGGGTGTGGG - Intronic
1058100504 9:100914093-100914115 AGTGCCAAGGAGATGGGATTGGG + Intergenic
1059167769 9:112095484-112095506 AATTCCAAGAAGGTAGGGCTTGG + Intronic
1059541759 9:115137341-115137363 AATTGCAAGCAGATTGGAGTTGG + Intergenic
1060884510 9:127140978-127141000 AATAGCAGGGAGTTGGGGGTAGG + Intronic
1061207698 9:129174236-129174258 AAGTCCAAGGAAATCGCGGTTGG - Intergenic
1187310393 X:18136031-18136053 AATTCCAAGAAAATGAGGGTAGG - Intergenic
1187569900 X:20490229-20490251 AATGCCAAGGAGATATGGGCAGG - Intergenic
1188368543 X:29340348-29340370 AATTGCCAAGAGCTGGGGGTAGG - Intronic
1188988659 X:36790684-36790706 ATATCCTAGGAGATGGGGATGGG - Intergenic
1189274845 X:39778247-39778269 AGTGCCAAGGGGATAGGGGTGGG - Intergenic
1190722091 X:53157833-53157855 GTTTTCAAGGGGATGGGGGTGGG - Intergenic
1190737723 X:53266798-53266820 AATTCCAAGAAGAAGGTGGGGGG + Intronic
1191689621 X:63926442-63926464 AATTCAAATGAGATTTGGGTGGG - Intergenic
1191900951 X:66040186-66040208 AACCCCAAGGAGGTGGGGGAAGG - Intergenic
1191987912 X:67001743-67001765 TATTCCATGGAGGTGGGTGTAGG - Intergenic
1192016002 X:67331921-67331943 AATTCACAGGGGATGGGGGCAGG - Intergenic
1192179641 X:68908465-68908487 AAGTCCAGGCAGATGGTGGTGGG + Intergenic
1194806398 X:98333791-98333813 GGTTACAAGGAGTTGGGGGTGGG + Intergenic
1196441165 X:115721425-115721447 AATTACCAGGAGGTGGGGGGAGG - Intergenic
1196444693 X:115839413-115839435 AATTACCAGGAGGTGGGGGGAGG - Intergenic
1198812485 X:140549657-140549679 TATTTCAGGGAGGTGGGGGTGGG - Intergenic
1199514564 X:148661881-148661903 AATAACAAAAAGATGGGGGTGGG - Intronic
1199579898 X:149350715-149350737 ACTTCTAAGGACATGGGGCTAGG - Intergenic
1199712020 X:150476437-150476459 TATGTCAAGGAGATGGGAGTTGG + Intronic
1200490034 Y:3813491-3813513 AATTCAAATGAGATTTGGGTGGG + Intergenic
1200804025 Y:7413620-7413642 ATTCCCAAGGAGATGGTGTTAGG - Intergenic