ID: 1023331251

View in Genome Browser
Species Human (GRCh38)
Location 7:39119252-39119274
Sequence TCAACAACGTTGAGGGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023331242_1023331251 23 Left 1023331242 7:39119206-39119228 CCTGGGATGCCCCTGGGAAAAGG 0: 1
1: 0
2: 3
3: 34
4: 243
Right 1023331251 7:39119252-39119274 TCAACAACGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 3
4: 49
1023331247_1023331251 12 Left 1023331247 7:39119217-39119239 CCTGGGAAAAGGGCACAATTAGA 0: 1
1: 0
2: 2
3: 12
4: 207
Right 1023331251 7:39119252-39119274 TCAACAACGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 3
4: 49
1023331246_1023331251 13 Left 1023331246 7:39119216-39119238 CCCTGGGAAAAGGGCACAATTAG 0: 1
1: 0
2: 1
3: 48
4: 1431
Right 1023331251 7:39119252-39119274 TCAACAACGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 3
4: 49
1023331241_1023331251 24 Left 1023331241 7:39119205-39119227 CCCTGGGATGCCCCTGGGAAAAG 0: 1
1: 0
2: 1
3: 23
4: 257
Right 1023331251 7:39119252-39119274 TCAACAACGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 3
4: 49
1023331245_1023331251 14 Left 1023331245 7:39119215-39119237 CCCCTGGGAAAAGGGCACAATTA 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1023331251 7:39119252-39119274 TCAACAACGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023331251 Original CRISPR TCAACAACGTTGAGGGCAAT TGG Intronic
903686337 1:25134981-25135003 TCAACAGGATTCAGGGCAATGGG - Intergenic
909796200 1:79739476-79739498 TCAAAAACTCTGGGGGCAATGGG - Intergenic
911511508 1:98812305-98812327 TCAACAATGTTGTGGGCCATGGG + Intergenic
914347004 1:146808523-146808545 TCAACAACATGGAGGTCACTAGG + Intergenic
914938127 1:151998454-151998476 CCAAAAAAGTTGAGGGTAATAGG - Intergenic
918391106 1:184063541-184063563 AAAACAACATTGAGGGAAATAGG - Intronic
920242832 1:204566051-204566073 TCAACGATGTTAAGGGCAAGAGG - Intergenic
920351878 1:205343284-205343306 ACAACATCGATGAGGGCAAGTGG - Exonic
924643509 1:245856226-245856248 CCAACAAAGTTGAGAGAAATGGG - Intronic
1072186422 10:93043483-93043505 TCAACTGTGTTGAGGGCACTGGG + Intronic
1075987896 10:126803820-126803842 GCAACAACGGTGAGGGGAAAGGG - Intergenic
1083903275 11:65654268-65654290 TCCACAAAGTTGGGGGCAGTTGG + Exonic
1087696307 11:101380218-101380240 TGAACAACCTTGAGGTCATTTGG - Intergenic
1090792671 11:130105373-130105395 TCACCCACGTGGAGTGCAATGGG - Intronic
1092390421 12:8072553-8072575 TCTACATCTTTGAGGGCCATAGG - Intergenic
1096152388 12:49322907-49322929 TCAACACCGTTGGCAGCAATCGG + Intergenic
1106242706 13:27923370-27923392 TCAACACCTCTGAGGGCATTTGG + Intronic
1113433180 13:110267823-110267845 TGTATAACATTGAGGGCAATAGG + Intronic
1128571629 15:68737755-68737777 TCCCCAACTTTGAGGTCAATGGG - Intergenic
1131554177 15:93382508-93382530 TCAGCAACGTGGGGGGCACTTGG - Intergenic
1131797307 15:96032367-96032389 TCAGCAATGTGGAAGGCAATAGG - Intergenic
1139986980 16:70906747-70906769 TCAACAACATGGAGGTCACTAGG - Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1156154301 18:34283356-34283378 CCAACAACTTAGAGGGGAATTGG - Intergenic
1159038976 18:63305209-63305231 TCAAAAATGTTCAGGGAAATTGG - Intronic
925311766 2:2889754-2889776 CCACCAACCTTGATGGCAATCGG - Intergenic
927104758 2:19813788-19813810 TCAACATCTATGAGGGTAATTGG - Intergenic
937565878 2:123288002-123288024 ACAACAATGTTGAGGGAAAATGG + Intergenic
941766567 2:169303726-169303748 TAAACAAGGTAGAGGGAAATAGG + Intronic
943871010 2:192999325-192999347 TCACCAACCTTTTGGGCAATAGG + Intergenic
1172413273 20:34742405-34742427 CCAACAACTTTGAAGGCCATCGG - Exonic
1177338927 21:19772688-19772710 TCAGCAATGTGGAGGGAAATGGG + Intergenic
950949728 3:16985862-16985884 TCATCAACATTGAGGGAAATGGG + Intronic
965259397 3:166461331-166461353 TTAACAACATTGATTGCAATTGG - Intergenic
971556411 4:28017712-28017734 TGAACAAGGTTGGGAGCAATAGG + Intergenic
980570982 4:134619572-134619594 TCCCCCAGGTTGAGGGCAATAGG + Intergenic
991073013 5:62507401-62507423 TCAACAACATTGAGAGAATTTGG + Intronic
1005520642 6:26597830-26597852 TGAAGAACGTTGCGGGCAGTGGG + Intronic
1010760398 6:79716033-79716055 TCACCAACGTTGCAGGCAAGGGG - Intergenic
1012622055 6:101357431-101357453 TCAACAATTTTGAGGGAAAGGGG - Intergenic
1020405077 7:7823999-7824021 TAAACAATGTTGAGGGCAAGTGG + Intronic
1023331251 7:39119252-39119274 TCAACAACGTTGAGGGCAATTGG + Intronic
1031227923 7:119064830-119064852 TCTCCAAATTTGAGGGCAATAGG - Intergenic
1031390138 7:121203581-121203603 TCAACTACACTGAGAGCAATTGG - Intronic
1034191255 7:149215100-149215122 TCAGCCATGTTGAGGGCAAGGGG - Intronic
1044923645 8:97190768-97190790 TCAACTAGATTGAGGGCATTTGG - Intergenic
1051851179 9:21510218-21510240 TCAACTACATTGAGGTCAAGGGG + Intergenic
1052920883 9:33967836-33967858 TCAACATCATTGATGTCAATAGG + Intronic
1056109929 9:83384808-83384830 TCAACAACACTGATGGAAATGGG + Intronic
1058553788 9:106144216-106144238 TCAGAAACGTTCAGTGCAATAGG + Intergenic
1060952378 9:127612410-127612432 ACAACAGCTTTGAGGCCAATGGG - Exonic
1191011694 X:55766647-55766669 TCAACAACCTTGTGAGCTATTGG - Intergenic
1200282183 X:154786275-154786297 TCAACAAGGATGACAGCAATTGG - Exonic