ID: 1023334816

View in Genome Browser
Species Human (GRCh38)
Location 7:39157888-39157910
Sequence CAGTAAAAATGAATGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023334808_1023334816 21 Left 1023334808 7:39157844-39157866 CCCTAAATGGTTAACTGTTATTC 0: 1
1: 0
2: 1
3: 11
4: 184
Right 1023334816 7:39157888-39157910 CAGTAAAAATGAATGCTGGATGG 0: 1
1: 0
2: 1
3: 29
4: 306
1023334809_1023334816 20 Left 1023334809 7:39157845-39157867 CCTAAATGGTTAACTGTTATTCC 0: 1
1: 0
2: 0
3: 12
4: 189
Right 1023334816 7:39157888-39157910 CAGTAAAAATGAATGCTGGATGG 0: 1
1: 0
2: 1
3: 29
4: 306
1023334813_1023334816 -1 Left 1023334813 7:39157866-39157888 CCTTCTGGGGCCTATAATAAAGC 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1023334816 7:39157888-39157910 CAGTAAAAATGAATGCTGGATGG 0: 1
1: 0
2: 1
3: 29
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023334816 Original CRISPR CAGTAAAAATGAATGCTGGA TGG Intronic
901337670 1:8465191-8465213 CATTAAAACTGTCTGCTGGATGG + Intronic
905590403 1:39158404-39158426 CCGTAAACATGACTGCTGTAAGG + Intronic
905679488 1:39857687-39857709 TAGTAAAAACGAATTCTGCATGG + Intronic
906189683 1:43889279-43889301 TAATAAAAATGAATACTGTATGG + Intronic
907399743 1:54217545-54217567 AAGTAGAAATGAAGGCAGGAAGG - Intronic
909214138 1:72864028-72864050 CAGTATTGATGAGTGCTGGAAGG - Intergenic
909320418 1:74279041-74279063 CATTATAAATCAATGCTGGAAGG + Intronic
909650175 1:77966167-77966189 GAGGAAAAATGAAGGCTGGTAGG + Intronic
910100600 1:83571344-83571366 AAGTAAAAATGGATACTGGCAGG - Intergenic
911398698 1:97346202-97346224 CAATAAAAATGAATGATATATGG - Intronic
911584428 1:99674177-99674199 GAGCAAGAATGAATGCTGAAAGG - Intronic
911758875 1:101592976-101592998 CTGAAAAAATGCATGCTGAATGG + Intergenic
917277930 1:173350741-173350763 CAGGCCAAAAGAATGCTGGAGGG + Intergenic
1063932061 10:11038614-11038636 CTATAAAAATGAATTCTAGAAGG + Intronic
1064293415 10:14055803-14055825 CACTAAAGATAAATGCTTGAGGG - Intronic
1064820593 10:19326544-19326566 CAGTAAAAATCAATTTTGAAAGG - Intronic
1066234487 10:33471914-33471936 CACAAAAAATAAATGCTTGAGGG - Intergenic
1067321227 10:45223095-45223117 CAGTGAGAACGAGTGCTGGAGGG + Intergenic
1067352156 10:45486261-45486283 CAGTAAAAATGTATTCAAGAAGG + Intronic
1067510289 10:46889121-46889143 CTGTGAAAATGAATGTTGCAGGG - Intergenic
1067651966 10:48162736-48162758 CTGTGAAAATGAATGTTGCAGGG + Intronic
1068193225 10:53681617-53681639 GAGCAAAAACAAATGCTGGAGGG - Intergenic
1068510286 10:57957132-57957154 CACGAAAAGTGAAGGCTGGATGG - Intergenic
1069535656 10:69250728-69250750 CTGTAAAAATGAAGGCAGGCTGG - Intronic
1071246442 10:83770211-83770233 TAGCAAATATGGATGCTGGATGG + Intergenic
1071492305 10:86144202-86144224 CAAAGAAAATAAATGCTGGATGG + Intronic
1072028379 10:91489512-91489534 CAGTAAATATGAATTCCTGATGG + Intronic
1072505892 10:96066589-96066611 CAGTAAAAATGAATTATAAAAGG + Intergenic
1074140766 10:110670538-110670560 CAGCAGAGATGAATGCTGCAGGG - Intronic
1074738691 10:116463485-116463507 CAGTAAGAGTGGATGCTGGAAGG + Intronic
1074949156 10:118312046-118312068 GTGTAAAACTGAAAGCTGGAGGG - Intronic
1077348437 11:2076166-2076188 CTGTAAAAATGACCACTGGATGG + Intergenic
1078984696 11:16581665-16581687 CCATAAAAATGAATGATGGCCGG + Intronic
1079367102 11:19819026-19819048 AAGTAAAAATGGATGGAGGAAGG - Intronic
1080929393 11:36792532-36792554 CAGTAAAAATGAATAATCTATGG + Intergenic
1082228651 11:49738815-49738837 CCCTAAAAATGAATGCTGCCTGG - Intergenic
1083751242 11:64761887-64761909 CATTAAAAAACAATGCTGGCCGG + Intergenic
1085130989 11:74038263-74038285 CAAAACAAAAGAATGCTGGATGG + Intronic
1085507484 11:77068544-77068566 GTGTGAAAATGAATGCTGGTGGG + Intronic
1085715277 11:78867074-78867096 CACAAAAGATAAATGCTGGAGGG - Intronic
1085882309 11:80482403-80482425 AAGCAAAAATGGATGCTGGATGG - Intergenic
1086380023 11:86243094-86243116 CAGATAATATGAATGCTGTAAGG + Intergenic
1087917785 11:103830887-103830909 CATTGAAAATGAATGGAGGAAGG + Intergenic
1088098356 11:106126053-106126075 CACTAAAATTGAAAACTGGAAGG - Intergenic
1089878479 11:121749570-121749592 CAGTAAAAAGGAAAAGTGGAAGG + Intergenic
1090311122 11:125741632-125741654 CAATTAAAATGAAACCTGGAAGG - Intergenic
1090687188 11:129135469-129135491 GAATAAAAATGAACGCTGGCCGG + Intronic
1093313534 12:17620489-17620511 CAGGGAAAAAGAATGCTGAAGGG + Intergenic
1093576432 12:20736045-20736067 CAGAAAAAATGAAGTATGGAGGG + Intronic
1094786638 12:33856119-33856141 CACAAAAAATAAATGCTTGAGGG - Intergenic
1095165791 12:38970067-38970089 TACTTAAAATGCATGCTGGAAGG - Intergenic
1098504304 12:71231579-71231601 CACAAAAAATAAATGCTTGAAGG + Intronic
1099074599 12:78090888-78090910 CAGTAAAAGTGAAAGATGAATGG + Intronic
1100088292 12:90937870-90937892 AAATAAAAATGAGTTCTGGAGGG + Intronic
1100314478 12:93431845-93431867 CAGCAGATATGAAAGCTGGAAGG - Intronic
1100580271 12:95932343-95932365 AAGGAAAAATGAGTGCTTGAGGG - Intronic
1100664396 12:96735512-96735534 CTGTAAAAATGACTGGTGGTGGG + Intronic
1100887133 12:99084051-99084073 CAGTAAAAATGATGCCTGGTTGG + Intronic
1101813065 12:108124206-108124228 CAGTACAAATGAATGAAGCATGG - Intergenic
1102467804 12:113140380-113140402 CAGTGTAAATGAATACTGCATGG + Intergenic
1104956298 12:132467719-132467741 CAGTAAAAAGGAATGATGGCCGG + Intergenic
1106760282 13:32860997-32861019 CAGTAAGATGAAATGCTGGAAGG - Intergenic
1107200160 13:37705697-37705719 AGGTAAATATGCATGCTGGAAGG - Intronic
1108549883 13:51533251-51533273 CACTAAAAAACACTGCTGGAAGG + Intergenic
1109324307 13:60849113-60849135 AAGTAAAAGTGAATGCTAGGAGG + Intergenic
1110049004 13:70871067-70871089 CAGCAAATATAAATGATGGATGG + Intergenic
1110317658 13:74129960-74129982 CCCTAAAAATGAATTCTGGCGGG + Intronic
1110621157 13:77597304-77597326 CAGAAAAAACAAATGCTGCAAGG + Intronic
1111801079 13:92981615-92981637 GAATAAATATGAATGCTTGAGGG + Intergenic
1112215305 13:97424478-97424500 CATTAAAAATGACTGCTTAAAGG + Intergenic
1114598709 14:23936220-23936242 CAGTGGAAATGAAATCTGGAAGG - Intergenic
1116893419 14:50291702-50291724 CAGGAAAAATAAAAGCTTGAAGG - Intronic
1120469073 14:84899264-84899286 TATTAAAAATGAATACTGGCTGG - Intergenic
1121976438 14:98408407-98408429 CAGCACCAATGAATGCAGGAAGG + Intergenic
1122304730 14:100755862-100755884 CAGAAACAATGGAAGCTGGAAGG + Intergenic
1122680976 14:103462764-103462786 CAGCAGAAATGAATGCCGGGTGG - Intronic
1125041599 15:35194152-35194174 AAATAAAAATGAATCCTAGAGGG - Intergenic
1126684946 15:51240458-51240480 CAGGAACAGTGAAAGCTGGAGGG - Intronic
1128621479 15:69154398-69154420 GAGTAAAAATGTCTGGTGGAAGG - Intergenic
1128961110 15:72005692-72005714 CAGAAAAAATAAACGCTGGGTGG + Intronic
1130245068 15:82239467-82239489 CAGTGAAAAAGAATGATGGATGG - Intronic
1130455611 15:84103949-84103971 CAGTGAAAAAGAATGATGGATGG + Intergenic
1130803853 15:87297517-87297539 AAGTAAAAAGCAATTCTGGAAGG + Intergenic
1131241416 15:90747022-90747044 AAGGATAAATGAAAGCTGGAAGG - Intronic
1132395478 15:101470583-101470605 CTATTAAAATGAATGCCGGAGGG - Intronic
1133521917 16:6566695-6566717 CAGTAAAGATGAAAAGTGGATGG - Intronic
1133542056 16:6765528-6765550 AAGAAAAAAAGAATGCTGGTGGG + Intronic
1134173940 16:11990875-11990897 CAGAAATAATGAAGGCTGGCAGG - Intronic
1134377236 16:13688536-13688558 CACAAAAGATGAATGCTTGAGGG - Intergenic
1134907997 16:17998376-17998398 CAATAAAAATATATGCTGAAGGG + Intergenic
1135360637 16:21810900-21810922 AACTAAAAATAAATGCTGGCCGG + Intergenic
1135772213 16:25226195-25226217 CACAAAAAATAAATGCTTGAGGG - Intronic
1136469772 16:30472404-30472426 CAGTGAAAAAGAATGAGGGAAGG - Intergenic
1136923193 16:34348077-34348099 CAGTAAAAATTGATACTGGATGG - Intergenic
1136981380 16:35063729-35063751 CAGTAAAAATTGATACTGGATGG + Intergenic
1137914193 16:52410987-52411009 CAGTAACAATGAATACTTCAAGG + Intergenic
1138975656 16:62204207-62204229 CAGTGAAACTGCATCCTGGAAGG + Intergenic
1139025912 16:62817480-62817502 CATTAAATATGAATGCAGGGTGG + Intergenic
1139060519 16:63245198-63245220 AAGTAAAAATGAATGCGTTAGGG + Intergenic
1139072312 16:63397876-63397898 CAGTAAATATTAATGATGGGAGG - Intergenic
1140015225 16:71175923-71175945 TAATAAAAATGAAAGCTAGAAGG - Intronic
1141519484 16:84568362-84568384 TAGTAAATATGAATCATGGAAGG + Intronic
1141576787 16:84969208-84969230 CAGCAATAATGAATCCTGAAGGG - Intergenic
1148592723 17:48828775-48828797 AATTAAAAATGAAGGCTGGCCGG - Intergenic
1150065666 17:62107098-62107120 TAATAAAAATAAATGCTGGCCGG + Intergenic
1152353174 17:79794624-79794646 GAGAAAAGATGAATGCTGGGTGG - Exonic
1152773043 17:82182284-82182306 AAAAAAAAAAGAATGCTGGAAGG + Intronic
1153426251 18:4967815-4967837 CACTAAGAATAAAGGCTGGAGGG + Intergenic
1154051516 18:10963903-10963925 CAATAAAAAGGAATGTGGGAGGG + Intronic
1155123514 18:22847036-22847058 CAGTTAAAATAAATGCTTTATGG - Intronic
1156757422 18:40545140-40545162 CTGAAAAAATGAATGCCTGAAGG + Intergenic
1157343067 18:46796862-46796884 CAGAAAAACTGAATGCAGGCTGG - Intergenic
1158130480 18:54147547-54147569 CAGTAAAAATGAAAGCACAAAGG + Intergenic
1158389984 18:57036995-57037017 AAGTAAAGAGGAAAGCTGGAAGG + Intergenic
1158562922 18:58530658-58530680 CAGCAGAACTGAATGATGGATGG + Intronic
1158705033 18:59784608-59784630 CTGTAAAAATGAGTGCTGTAAGG - Intergenic
1162075490 19:8184061-8184083 AAGAAAAAAAAAATGCTGGATGG - Intronic
1162221493 19:9180826-9180848 AAGTAAAAAATAATGCTGGCTGG + Intergenic
1162697221 19:12485581-12485603 CAGTAAAACTGAACACTGGAAGG + Intronic
1163072630 19:14857077-14857099 CACAAAGAATGAATGCTTGAAGG - Intergenic
1163495160 19:17642236-17642258 GAGTATAGATGAATGATGGATGG - Intronic
1166078967 19:40431544-40431566 CCATAAAAATGGATTCTGGAGGG - Intergenic
1167108101 19:47442638-47442660 CAGTATAAGGGAGTGCTGGAGGG - Intronic
1167190695 19:47987148-47987170 TGGTAAACATGAATTCTGGAAGG + Intronic
1168354683 19:55693825-55693847 AAGGAAAACTGCATGCTGGAAGG - Intronic
925143014 2:1562984-1563006 CAATAAAAATAAATTCTGGCTGG - Intergenic
926999635 2:18780390-18780412 CAGTAAGAATGAAAGAAGGAAGG - Intergenic
927379887 2:22467275-22467297 CATTAAAAGTGAATGCAGGCTGG + Intergenic
927406114 2:22769602-22769624 CAGTAAAAAAGAGAGCTGAATGG + Intergenic
928026404 2:27742963-27742985 CATCAAAAATAAATGGTGGAGGG - Intergenic
928053541 2:28027070-28027092 CAGACAAAATTAATGATGGATGG - Intronic
928797746 2:35043154-35043176 CAGTAAATATTAATTCTGGCAGG + Intergenic
929286762 2:40143852-40143874 CAGAAAAAGAGACTGCTGGAAGG + Intronic
929960843 2:46495177-46495199 CAGCAAAAATGGAAGCTGAAAGG - Intronic
931568364 2:63640786-63640808 CACAAAAAATGAATGCTTGAGGG - Intronic
935662142 2:105476045-105476067 AAGTAAAAATGCATGCTGTTTGG + Intergenic
936751127 2:115643417-115643439 CAGTAAAACTGAAAGCTCAAGGG + Intronic
937538062 2:122915427-122915449 CAGCAAAAAATGATGCTGGAAGG + Intergenic
937816712 2:126258713-126258735 CAGCAAAAACGAATCCAGGAAGG - Intergenic
939121290 2:138120804-138120826 CATTAAAAATCATTGCTGGCTGG + Intergenic
939258721 2:139779220-139779242 CAGATAAAATGAATCCTTGAAGG + Intergenic
939477515 2:142705610-142705632 CAGTTAGAATGCATTCTGGATGG - Intergenic
940483780 2:154271895-154271917 CTATAAAAATAAATGCTGAATGG + Intronic
940493748 2:154398672-154398694 CACTCAAAATGAAAGCTGTAAGG - Intronic
940791498 2:158034195-158034217 TGGTAAAAATGCATGCAGGAAGG - Intronic
943484202 2:188458649-188458671 CACTAAGAATAAATGCTTGAAGG - Intronic
943581396 2:189687610-189687632 AGGCAAAAATGAATGCTGGCAGG - Intronic
943792851 2:191954181-191954203 CTATAAAAATGAATGCAGGCCGG - Intronic
943864669 2:192914528-192914550 CACAAAAAATAAATGCTTGAGGG + Intergenic
944343412 2:198631213-198631235 TACTGAAAATGAATGCTGGCAGG - Intergenic
944354796 2:198774475-198774497 CAGTAGACCTAAATGCTGGAAGG - Intergenic
946122434 2:217528124-217528146 TAGTAATAATGATTACTGGATGG - Intronic
946929861 2:224660865-224660887 CAATAAAAATAAATGTTGGGTGG - Intergenic
1169158731 20:3357622-3357644 CAGTAAAAGATAAAGCTGGATGG - Intronic
1169902185 20:10564780-10564802 CAGTAAAAATTAATGGTATAAGG + Intronic
1170088839 20:12567600-12567622 CAGTAAAAATGCCTACGGGATGG + Intergenic
1170903259 20:20486864-20486886 CAGAAACAAAGAATGCCGGATGG - Intronic
1170994822 20:21342910-21342932 CAATAAAAATAAATACAGGAAGG - Intronic
1172100312 20:32481354-32481376 CAGCCAAAAGGAAGGCTGGAAGG + Intronic
1172646750 20:36475009-36475031 CAGGGAAAGTGACTGCTGGATGG + Intronic
1172921502 20:38486715-38486737 TAGTAAAAATAAAAGTTGGATGG - Intronic
1173851535 20:46221535-46221557 CAGTAAACGTGAAAGCTGCAAGG + Intronic
1175588131 20:60162697-60162719 CATTAAAAATGAATGCTGGCTGG + Intergenic
1177722364 21:24924860-24924882 CAATCAAAATGAATGCAGAACGG - Intergenic
1181580554 22:23825703-23825725 CAGGACAACTGAATGGTGGATGG - Intronic
1183118317 22:35709553-35709575 CAGGAAAAATGGTTGCTGAATGG - Intergenic
1183265713 22:36823997-36824019 CAGAGAATGTGAATGCTGGAAGG + Intergenic
1184620067 22:45670607-45670629 CAGAAAAAGTGAATCCTGGTGGG - Intergenic
949835275 3:8262200-8262222 CAGGAACCATGAAGGCTGGAAGG - Intergenic
950146620 3:10654622-10654644 CAGGATAAATCTATGCTGGAGGG - Intronic
952812302 3:37415247-37415269 CAGAAAAAAAGAATTCTAGAAGG - Intronic
953165117 3:40457776-40457798 CAGCGAAAAAGAATGCTGCAGGG - Intronic
955001955 3:54935319-54935341 CAGGACAACTGAATGCTGGAAGG - Intronic
956729071 3:72180022-72180044 AAGAAAAAATGAAAGCTGAACGG - Intergenic
958847570 3:99283254-99283276 CTGGAAAAATAAATGCTTGAGGG + Intergenic
960024533 3:112993174-112993196 CATGAATAATAAATGCTGGAAGG + Intronic
960094589 3:113677049-113677071 AAGTAGACATGAATGCAGGAAGG + Intronic
961050695 3:123743687-123743709 AAGTAAAAGAGAATGCTGGCAGG + Intronic
961485782 3:127214946-127214968 CAGCAACAATGGAGGCTGGAGGG + Intergenic
961491000 3:127256955-127256977 CATGAAGAATGAATGCTGGCTGG - Intergenic
962650826 3:137488723-137488745 CAGTAAAAATGAATGAACTATGG - Intergenic
962757093 3:138473361-138473383 AATTATACATGAATGCTGGATGG + Intronic
963742637 3:149095873-149095895 CAGAAAAAATGATGGGTGGATGG + Intergenic
964018253 3:151974693-151974715 CAAAATAAATGAATGGTGGAAGG - Intergenic
964203554 3:154145476-154145498 CAGTATAAATTAGTGCTTGATGG + Intronic
964205167 3:154166344-154166366 CATTAAAAATAAATACTGGCTGG - Intronic
964818913 3:160748527-160748549 CAGTAAAAATTCCAGCTGGAAGG + Intergenic
965789373 3:172371537-172371559 CAGTCTAAATGAATTCTTGATGG - Intronic
965895679 3:173572580-173572602 CAGTAAATATGAAAGCAGAAGGG - Intronic
966306031 3:178535842-178535864 CGGCAAGAATGAATGATGGATGG - Intronic
966655068 3:182346979-182347001 CAATAAAAGTCAAAGCTGGAAGG + Intergenic
972009828 4:34163949-34163971 CACAAAAAATAAATGCTTGAGGG + Intergenic
973786206 4:54335017-54335039 CAGGAAAAATGAAGGAAGGAAGG - Intergenic
974085342 4:57254610-57254632 CTGGCAAAATGAATGCTGGATGG - Intergenic
974425080 4:61732160-61732182 AATTAAAAATGAGTGATGGATGG - Intronic
974558454 4:63484566-63484588 CAGTTAAAATGAAAGATGGGTGG - Intergenic
975090322 4:70394235-70394257 CAGTAGGGAGGAATGCTGGAAGG + Intergenic
977377098 4:96219645-96219667 CATTAAAAGTGAATACTGTAGGG - Intergenic
978608305 4:110507255-110507277 TAGAAAAAATTATTGCTGGAAGG - Intronic
979416768 4:120450904-120450926 ATGTACAAATGAATGTTGGAGGG + Intergenic
979490020 4:121315286-121315308 CTGTTAAAATGAGTGGTGGATGG - Intergenic
979762279 4:124421032-124421054 CAATAAATACGAATGCTGCATGG + Intergenic
979859137 4:125671892-125671914 GAGTAAAAGTGAATGCTGGCCGG - Intergenic
983675885 4:170291994-170292016 CAGCATAAATTAATGATGGATGG - Intergenic
984541048 4:181037255-181037277 CACAAAAAATAAATGCTTGAGGG - Intergenic
987170225 5:15248170-15248192 TAGTAAAAATGAAGACTGAAGGG + Intergenic
987617176 5:20291372-20291394 CAGTTAAAGTGAATGATGAATGG + Intronic
988954617 5:36302492-36302514 AAGTCATAATGAATGCTGGTAGG + Intergenic
989092429 5:37747359-37747381 CAGGAAGAATAAATGCTGGGAGG + Intronic
990345647 5:54868476-54868498 CAGTAAAACTGAATACAGGAAGG - Intergenic
992042739 5:72851788-72851810 TATTAAAAATGAATGCTGGCTGG - Intronic
992291662 5:75285698-75285720 CAGGACAACTGAAAGCTGGAAGG - Intergenic
993103988 5:83577694-83577716 CATTAAAAATCAATTCTAGATGG - Intronic
993654024 5:90556254-90556276 CCATAAAAATGAAAGCTGCATGG - Intronic
993814787 5:92529266-92529288 AATAAAAAATGAATTCTGGAAGG + Intergenic
994295757 5:98085918-98085940 AAGAAAAAATGAATAGTGGAAGG + Intergenic
994960686 5:106598004-106598026 AAGTAAAAAAGAATGGAGGAGGG + Intergenic
995218398 5:109621191-109621213 CAGAAAAAAAGTATGCTGAAAGG - Intergenic
996486662 5:124042769-124042791 CAACAAAAATGAATCCTGTAAGG + Intergenic
996757093 5:126946632-126946654 CAGTAAAAATGGATGCTCCTTGG + Intronic
996758338 5:126959534-126959556 AAGTAAATATGAATGATGTATGG + Intronic
999136993 5:149328105-149328127 CAGTAACAATGAAAGCCAGAAGG + Intronic
999980829 5:156956330-156956352 CATAAAAAAAAAATGCTGGAGGG + Intronic
1001349093 5:170939082-170939104 CAGTAAAAATGGAAGCCAGAAGG + Intronic
1001747903 5:174106057-174106079 CAGTAAGGATGAGTGATGGAAGG + Intronic
1002627619 5:180542035-180542057 CAGAAACAATGCACGCTGGAAGG - Intronic
1002828699 6:798525-798547 CAGGAAAAATGAATGGAGAAAGG - Intergenic
1003390826 6:5711269-5711291 CAATATAAATGAATGCGGGATGG + Intronic
1003640160 6:7869377-7869399 CAGATAAAAAGGATGCTGGATGG + Intronic
1004278449 6:14258649-14258671 CAGTAAAAAAAAAGGCTGGTGGG + Intergenic
1005232156 6:23714885-23714907 GGGGAAAAATGAATGCTGGCTGG - Intergenic
1005238128 6:23790193-23790215 CAGCACAAATGAATGTTGTAAGG + Intergenic
1005562832 6:27058882-27058904 CTGTAAAATTTAATGCTGGTGGG + Intergenic
1005755138 6:28919308-28919330 CATTAAAAATGGATGATGGCGGG - Intronic
1005906188 6:30262943-30262965 CAGCAAAAATGGATTCTGGAAGG - Intergenic
1007675639 6:43592238-43592260 CATGAAAAATGATTTCTGGAAGG - Intronic
1008243796 6:49145754-49145776 AAGAAAAAATGGATGCTGGTGGG - Intergenic
1008404084 6:51099647-51099669 AAGAATAAATGTATGCTGGAGGG + Intergenic
1008869273 6:56252799-56252821 AAGGAAAAATGAATGCTGGGTGG + Intronic
1010090850 6:71979878-71979900 CAGTAAAAATGAAGATTAGATGG + Intronic
1011844511 6:91546720-91546742 AAGTAAGAATGGCTGCTGGAAGG + Intergenic
1011900494 6:92289044-92289066 CAGTATATATGAATGCTGAGAGG + Intergenic
1012248964 6:96958979-96959001 CAGTACTTATGAAAGCTGGAAGG + Intronic
1012769739 6:103416730-103416752 CATTAAAAATCAATACTGTAAGG - Intergenic
1013790486 6:113831160-113831182 AAGAAAGAATGAATGATGGAAGG + Intergenic
1013820746 6:114150960-114150982 CAGTAAAAATGCAAGGTGAAAGG - Intronic
1013983630 6:116163913-116163935 AATTAGAAATGAATGCTGAAAGG - Intronic
1014041295 6:116829488-116829510 CAGGAAAAATAAAAGCAGGATGG - Intergenic
1015686960 6:135875640-135875662 AAGTAAAAATGAATTCATGAAGG - Intronic
1015950202 6:138545510-138545532 CAGTAAAAATCAAAGTTTGAGGG - Intronic
1017161863 6:151372807-151372829 CAGGAAAGATTACTGCTGGAAGG + Intronic
1017915370 6:158827454-158827476 CAGTAAGAAGCAATGCTTGATGG + Intergenic
1019302774 7:316644-316666 GAATAAAAATGAATTCTGGCCGG - Intergenic
1020533384 7:9363343-9363365 AAATAAAAATGAATGTGGGATGG + Intergenic
1020560415 7:9724244-9724266 TAGTAAATATGAATTCTGGTGGG - Intergenic
1021277041 7:18664269-18664291 CAGTAACAATGGATGTTAGATGG + Intronic
1022753311 7:33255642-33255664 TAGTTAAAATAAATGCTGCAAGG - Intronic
1022972618 7:35531386-35531408 CAGAAAAGATAAATGCTTGAGGG + Intergenic
1023333626 7:39145819-39145841 AAGTAAAAATGAATAGAGGATGG - Intronic
1023334816 7:39157888-39157910 CAGTAAAAATGAATGCTGGATGG + Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024044567 7:45578022-45578044 CTGGAACAATGAATGCTGCAGGG - Intronic
1024166992 7:46744961-46744983 CAGAAAAAAAAATTGCTGGATGG - Intronic
1024320589 7:48063512-48063534 TAGTAAAAATGCATGGTGAAGGG + Intergenic
1024426490 7:49232147-49232169 CAGTAAAAGTGAACCCTGGCTGG + Intergenic
1024448719 7:49513369-49513391 AAGCAAAAATGAATACTGAAGGG - Intergenic
1024935459 7:54707455-54707477 CAGGAAAAATGGAGGCGGGAAGG + Intergenic
1025075921 7:55943094-55943116 CAGCAAAAAGGAATGTAGGAGGG + Intergenic
1026247138 7:68630931-68630953 CACAAAAAATAAATGCTTGAGGG - Intergenic
1027502999 7:78978923-78978945 CTGAATAAATGAATGGTGGATGG + Intronic
1028193972 7:87883623-87883645 CAATGAAAATGAATGTTGGTCGG + Intronic
1028220867 7:88195131-88195153 CAGTAAAAATGGAATTTGGATGG + Intronic
1029154374 7:98504640-98504662 ATGTAAAAATGAATTCTAGATGG + Intergenic
1029899675 7:104025566-104025588 TAGTAAGAGTGAATACTGGATGG + Intergenic
1031346141 7:120669866-120669888 CAGTAATAATAAAGGCTAGAGGG + Intronic
1031932983 7:127705113-127705135 CAGTCTAATTGAATGCTGGATGG + Intronic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032758803 7:134918121-134918143 CAGTAAATATGGATTTTGGAAGG - Intronic
1033184850 7:139218106-139218128 CAGAAAAAAACAATGCAGGATGG - Intergenic
1033221094 7:139526494-139526516 CAGAAAGAATGAATGCATGATGG - Intronic
1033773934 7:144585450-144585472 CAGTTAAAATGAATATGGGAAGG - Intronic
1034160967 7:148994061-148994083 AAATAAAAATAAAGGCTGGAGGG - Intergenic
1034724633 7:153324176-153324198 CCGTAAAAATATATGGTGGATGG - Intergenic
1037637527 8:20712926-20712948 CAGTAAAAAGGAATGAGGCAAGG + Intergenic
1039831505 8:41218896-41218918 CAGTAAGAAACAATGCTGCATGG - Intergenic
1045561387 8:103267241-103267263 CAGCATGAAGGAATGCTGGAAGG - Intergenic
1045621707 8:103985527-103985549 CACAAAAGATGAATGCTTGAAGG + Intronic
1045686919 8:104722000-104722022 CCCTAAAAATCAAGGCTGGAGGG - Intronic
1046005430 8:108476354-108476376 CAGTACAACTGAATGCTATAAGG + Intronic
1047741388 8:127809753-127809775 CAGTCACAATAAATGCCGGAAGG - Intergenic
1047965652 8:130044520-130044542 AGGTGAAACTGAATGCTGGACGG - Intergenic
1048386915 8:133920585-133920607 GACTAAAAATGAAAGCTGCAAGG + Intergenic
1049502151 8:142972948-142972970 CAATAAAAATAAATTCTGAAAGG + Intergenic
1049991260 9:993945-993967 GAGTAAAACTGAATGCTGGGAGG - Intergenic
1052106252 9:24520816-24520838 GAGTAAAAACGAATCCTGAAGGG - Intergenic
1052581705 9:30364633-30364655 AAATAAACATGATTGCTGGAAGG - Intergenic
1052668670 9:31527182-31527204 GAGTAAAACTGAAGGCAGGAAGG + Intergenic
1053577431 9:39366801-39366823 CAATAAAAATGAATTATGAATGG + Intergenic
1054099006 9:60925520-60925542 CAATAAAAATGAATTATGAATGG + Intergenic
1054120404 9:61201142-61201164 CAATAAAAATGAATTATGAATGG + Intergenic
1054762446 9:69014924-69014946 CAGTAAAACTGAATTTTGGGGGG - Intergenic
1055412937 9:76051154-76051176 CAGTAAAAATGAACCCTGGTTGG - Intronic
1055940626 9:81645766-81645788 AAATAAAAATAAATGCTTGAGGG + Intronic
1057405410 9:94765913-94765935 CATTTAAAATGACTGATGGAAGG + Intronic
1057552053 9:96058778-96058800 CAGTAAAAAGGAATTGTAGAGGG + Intergenic
1061056817 9:128227299-128227321 CAGTAAAAAAGAATGCGCGGTGG - Intronic
1186407872 X:9319595-9319617 AAGGAAAAATAAATGCTGTAGGG + Intergenic
1188323241 X:28766510-28766532 CACAAAAAATAAATGCTTGAGGG - Intronic
1188597105 X:31914904-31914926 CACAAAAGATTAATGCTGGAGGG + Intronic
1188668234 X:32851500-32851522 CGGGAAAGATGATTGCTGGAAGG - Intronic
1188923959 X:36016117-36016139 CACAAAAAATAAATGCTTGATGG - Intergenic
1188948491 X:36338185-36338207 CATTAAAAATGTATTATGGAAGG - Intronic
1189488645 X:41452385-41452407 AAGAAAAAATGAAGGCTGGAGGG + Intronic
1189876875 X:45445530-45445552 AAGTCAATATGAATGCTGGGTGG + Intergenic
1190898567 X:54646223-54646245 TAGAAAAAATGAATGGTGGCTGG + Intergenic
1191634054 X:63356888-63356910 AAGTAAAAATGAGGGGTGGATGG + Intergenic
1191636955 X:63389237-63389259 CACAAAGAATGAATGCTTGAGGG + Intergenic
1193079232 X:77389827-77389849 CACTAAAAATAAATGCTTGAGGG + Intergenic
1193391635 X:80936347-80936369 CACTAAGAATAAATGCTTGAGGG - Intergenic
1193530020 X:82644881-82644903 GAGAAAAAATGATTGCTGGGGGG + Intergenic
1193715493 X:84930907-84930929 CATTAAAGATGAATGATGGCTGG - Intergenic
1193872152 X:86812941-86812963 CAGCAAAAATGAATGGTCCAGGG - Exonic
1194307156 X:92261059-92261081 AAAAAAAAATCAATGCTGGAAGG - Intronic
1194534690 X:95091849-95091871 CACAAAAAATAAATGCTTGAGGG + Intergenic
1194564142 X:95462138-95462160 CATAAAATAGGAATGCTGGATGG + Intergenic
1195779885 X:108450388-108450410 AAGTAAAAATGAATTTTGGCTGG - Intronic
1196170063 X:112577608-112577630 CACAAAAAATAAATGCTTGAGGG - Intergenic
1196596558 X:117552660-117552682 CAGTGAAAATGAATGAAGGCTGG + Intergenic
1197449133 X:126589483-126589505 CAGAAAAGATAAATGCTTGAGGG - Intergenic
1197947004 X:131850310-131850332 CATCAAGAATGAATGCTGGTAGG - Intergenic
1198640708 X:138752914-138752936 CAATAAAAATGAGTTATGGAAGG - Intronic
1200836277 Y:7735159-7735181 TAGTAAAAATGAAAGCTATATGG + Intergenic
1201560457 Y:15310655-15310677 CAGTACAATTCAATGATGGAGGG + Intergenic
1202270176 Y:23063980-23064002 CTGTAAAACTGAATGCTAGATGG + Intergenic
1202295851 Y:23356702-23356724 CTGTAAAACTGAATGCTAGATGG - Intergenic
1202423170 Y:24697725-24697747 CTGTAAAACTGAATGCTAGATGG + Intergenic
1202447619 Y:24972361-24972383 CTGTAAAACTGAATGCTAGATGG - Intergenic