ID: 1023335539

View in Genome Browser
Species Human (GRCh38)
Location 7:39165234-39165256
Sequence AAGGGTTAACAGATGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023335539_1023335543 -7 Left 1023335539 7:39165234-39165256 CCCTCCTTCATCTGTTAACCCTT 0: 1
1: 0
2: 0
3: 21
4: 282
Right 1023335543 7:39165250-39165272 AACCCTTTTAAGCCAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023335539 Original CRISPR AAGGGTTAACAGATGAAGGA GGG (reversed) Intronic
900535872 1:3177032-3177054 ATGAGTTAACAGATGGATGAGGG - Intronic
900540986 1:3202571-3202593 AAGGGTCTGCAGGTGAAGGATGG + Intronic
900930975 1:5737314-5737336 AATGGTTGACAGATGGATGATGG + Intergenic
901510921 1:9717692-9717714 GAGGGGTAGCAGAGGAAGGAGGG + Intronic
901636082 1:10670814-10670836 GAGGGGTCACAGCTGAAGGATGG - Intronic
901760439 1:11467732-11467754 AAAGGTGAACAGATGCAGGAAGG + Intergenic
902675611 1:18006556-18006578 AGGGGGGAACAGAAGAAGGAAGG + Intergenic
903692379 1:25183689-25183711 AAGGGTGGAGAGATGAAGGACGG - Intergenic
904041111 1:27585784-27585806 AAGAGTTAACAGTTGGAGGAAGG - Intronic
904041663 1:27588917-27588939 AAGAGGGAACACATGAAGGAAGG + Intronic
905297376 1:36962753-36962775 AACGGATAAAAAATGAAGGAAGG + Intronic
905870205 1:41399213-41399235 AAGGGTTAACAGGCTAGGGAAGG + Intergenic
906409057 1:45564569-45564591 AAGGGGGAAAAGATTAAGGAAGG - Intronic
907607692 1:55835044-55835066 AATGGTTACAAGGTGAAGGAAGG - Intergenic
909546792 1:76857282-76857304 AAGGGGTAGCAGCTGCAGGAAGG - Intergenic
910280876 1:85500176-85500198 AAGGAAGAAAAGATGAAGGAAGG - Intronic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
911885115 1:103288285-103288307 CAGTGTTGAAAGATGAAGGAAGG + Intergenic
912547392 1:110460802-110460824 AAGGATACACAAATGAAGGAAGG - Intergenic
912592883 1:110844648-110844670 AAAAGTTAACAGATGGAGAAAGG - Intergenic
912877188 1:113371734-113371756 AAGGGAAAACAGATCACGGAGGG + Intergenic
913481696 1:119294868-119294890 AAGCTTTAACAAAAGAAGGAGGG - Intergenic
913653492 1:120940154-120940176 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914167605 1:145188874-145188896 AAGGGTAAAAAGAAAAAGGAGGG + Intergenic
914519183 1:148400278-148400300 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914643676 1:149634313-149634335 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
915769332 1:158403243-158403265 AAGGCCTAAGAGATGAAGGCAGG + Intergenic
915835590 1:159172734-159172756 AATGGTAGAGAGATGAAGGAAGG + Intronic
916042490 1:160973228-160973250 AAGGGGCAACAGATGAGGCAAGG + Intergenic
916449500 1:164906620-164906642 AGGGGTTTAAAGATGAAGAAGGG + Intergenic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
920675934 1:208038772-208038794 AGGGGTTGAGAGGTGAAGGAAGG - Intronic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921174474 1:212582220-212582242 AAGGGTTGCCAGATAAAGTACGG - Intronic
923732271 1:236563642-236563664 ATGCGTTAACAGATGAAGAAGGG - Intronic
1063016373 10:2081680-2081702 AAGGGTTATCAGCAGAAGCAAGG - Intergenic
1064639139 10:17397653-17397675 AATGGTTAACAAATGCAGGCAGG - Intronic
1064937244 10:20691855-20691877 AAGGATTAAAAAATGAAGGTGGG - Intergenic
1070568945 10:77626393-77626415 AAGTGTTCCCAGATGCAGGAAGG + Intronic
1070987008 10:80697787-80697809 AAGGATAAAAAGAGGAAGGAAGG - Intergenic
1071727593 10:88215648-88215670 AAGGGCTAACAGATAATGAATGG - Intergenic
1073578822 10:104645441-104645463 AAGGGTTAATCCAAGAAGGAGGG - Intronic
1074298423 10:112211886-112211908 AAAGATTAACAGATGTATGAGGG + Intronic
1074846127 10:117399630-117399652 AAGGGTGCACAGAAGAAAGATGG - Intergenic
1074967465 10:118504045-118504067 AAAAGTAAACAGAGGAAGGAAGG + Intergenic
1077280498 11:1742872-1742894 GAGGATGAACAGATGATGGATGG + Intronic
1078295477 11:10064568-10064590 AAAGGTTAAAAGAAAAAGGAGGG + Intronic
1079377701 11:19908370-19908392 AGAGGTTAACGGAGGAAGGAGGG - Intronic
1080144549 11:28965613-28965635 AAGACTTACCAGATGAAGGTTGG - Intergenic
1081692883 11:45089934-45089956 AAGACTTAATAGAAGAAGGAAGG + Intergenic
1082962506 11:58932856-58932878 AAGGGAGATAAGATGAAGGAGGG + Intronic
1084533962 11:69746031-69746053 AGGGGCAAAGAGATGAAGGAGGG + Intergenic
1085838698 11:79984790-79984812 AGGGCTTAACAGATTGAGGACGG + Intergenic
1086479167 11:87215648-87215670 AAGGGCTAACCCAGGAAGGATGG + Intronic
1086571318 11:88287692-88287714 AATGGTTAACAGAGGCTGGAAGG - Intergenic
1086797515 11:91125992-91126014 AGGGGGTAAAGGATGAAGGATGG + Intergenic
1088258699 11:107925246-107925268 GAGGGAAAAGAGATGAAGGAAGG + Intronic
1088353172 11:108912462-108912484 AAGGTATAACATTTGAAGGAAGG - Intronic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1093109344 12:15130427-15130449 AAAAGTTAACAGATGAAGCCAGG + Intronic
1093640451 12:21521455-21521477 AAGGGTTACCAGTTTTAGGAGGG - Intergenic
1094037869 12:26090048-26090070 AAGAGGTAACAGATGGAAGAAGG + Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1096137529 12:49214929-49214951 AAGTGTTAGCTGAGGAAGGAAGG - Intronic
1096252341 12:50041171-50041193 AAGGCTTCACAGAGGCAGGAGGG - Intergenic
1097922434 12:65090622-65090644 GAGGTTAAACAGGTGAAGGAGGG + Intronic
1098037106 12:66315501-66315523 AAAGGTTTATAGTTGAAGGATGG - Intronic
1098239035 12:68447392-68447414 AAGGGTTAACAGCCTCAGGAAGG + Intergenic
1099110537 12:78554721-78554743 TGGTGTTAACAGATGAAGGAAGG - Intergenic
1100736588 12:97541530-97541552 AATGTTTAACTGTTGAAGGAAGG - Intergenic
1105855865 13:24371346-24371368 GAGGGTGAGCTGATGAAGGAGGG + Intergenic
1107229569 13:38091831-38091853 AAGGGAAAACAGAGGAAGAAGGG + Intergenic
1107820983 13:44285469-44285491 AAGGGTCAACAGTGGAAGCAGGG - Intergenic
1108001054 13:45906287-45906309 AAGAGTTAACAAGTGAATGAAGG - Intergenic
1109054643 13:57532105-57532127 AATAGTGAAAAGATGAAGGAAGG + Intergenic
1109466412 13:62739008-62739030 AAAGGTTAAGAGATAAAGTAAGG - Intergenic
1110207767 13:72937080-72937102 ACGGGTTAAAAGAAGAAGGCTGG - Intronic
1110321414 13:74164431-74164453 AAGTGTTAACACATGAAAGTAGG + Intergenic
1110752788 13:79135494-79135516 AAGAGTTAACATCAGAAGGAAGG + Intergenic
1112752973 13:102600293-102600315 AGGAGTTTACAGATGACGGATGG - Intronic
1112858026 13:103794670-103794692 AAGGTTTAGCTGATGAGGGATGG + Intergenic
1114621885 14:24101072-24101094 AAGGGTGATTAGATGAAGCAAGG - Intronic
1115043921 14:28966320-28966342 AAGTTTTAACTGAAGAAGGATGG - Intergenic
1116787015 14:49298944-49298966 ACAGCTTAAAAGATGAAGGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117000194 14:51364195-51364217 ATGGGTTAACAGAGAAGGGAAGG + Intergenic
1117621577 14:57592749-57592771 AAGGGTAAACAGAGGAAGAGAGG - Intronic
1118099587 14:62581557-62581579 AAGGGATAACATATGAGGCAAGG - Intergenic
1119411218 14:74431961-74431983 AAGAGTGAACAGGTGAGGGAGGG + Intergenic
1119552503 14:75525234-75525256 AAGGGTTCCCAGATGGCGGAGGG - Intronic
1119610712 14:76059556-76059578 CAGGGTTATCAGATAAAGAAGGG - Intronic
1119995398 14:79248233-79248255 AAGGGAGAGCAGATGAAGAAGGG - Intronic
1120091742 14:80340389-80340411 AAGGGTATACAGCTGTAGGAGGG - Intronic
1120094620 14:80374716-80374738 AAGGGTTAAAAAATTAAGGACGG - Intronic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1125991575 15:44113985-44114007 AAGGGTAAACATATAATGGATGG + Intronic
1126973693 15:54149413-54149435 AAGGGTTAACAGATGTAAACAGG + Intronic
1127448253 15:59088205-59088227 CAGGGTGAACAGGTGAAGGGAGG + Intronic
1127625356 15:60775094-60775116 AAGGGTTGAAAGAAGAAAGAAGG - Intronic
1129147512 15:73662271-73662293 CAAAATTAACAGATGAAGGATGG - Intergenic
1129748407 15:78041519-78041541 AAGGCTTAAAAGATAAATGAAGG - Intronic
1133461906 16:5994047-5994069 AAGAGTTAAATGATGCAGGATGG + Intergenic
1133571982 16:7050070-7050092 AACTGTTAAAAGATGAAGTAGGG - Intronic
1134071851 16:11265169-11265191 CAGGGTGAACAGGTGAAGGGAGG - Intronic
1136232579 16:28895245-28895267 AAGGAATAACAGATGAAGTTGGG - Intronic
1137421092 16:48334697-48334719 GAGGGCAAACAGCTGAAGGATGG - Intronic
1137476385 16:48812996-48813018 AATGGCTAGCAGAAGAAGGATGG + Intergenic
1140788753 16:78369014-78369036 AAGAGTTGAGAGAGGAAGGAAGG - Intronic
1143008547 17:3852912-3852934 AAGGCTTCCCAGAGGAAGGAAGG - Intergenic
1143546781 17:7601623-7601645 AAGGGTTAAGAAATGAAGCTAGG + Intronic
1143766312 17:9139821-9139843 ATGGATGAACAGATGATGGAAGG - Intronic
1146427762 17:32759276-32759298 AACGTTTAACACATGATGGAAGG + Intronic
1146582669 17:34052932-34052954 AAGGGAGAAAAGATGAGGGATGG - Intronic
1146951865 17:36912556-36912578 AAGGCCACACAGATGAAGGAGGG - Intergenic
1147142573 17:38467616-38467638 AAGGAAGAACAGATGATGGATGG - Intronic
1147706663 17:42429995-42430017 AAGGGTTCACAGGTGAGGGTAGG + Intergenic
1148465618 17:47863445-47863467 AAGGACGAATAGATGAAGGAAGG + Intergenic
1149716233 17:58793175-58793197 CAAGGTTAAAAGATGAAGAAGGG - Intronic
1149986554 17:61352137-61352159 TAGGGCTAACAGCTGAACGAAGG - Intronic
1150007208 17:61477183-61477205 AAGGGTTAACAGAAGCCGCAGGG + Intronic
1151129650 17:71883186-71883208 AAGGCTTGAAAGATGGAGGAGGG + Intergenic
1153234034 18:2968651-2968673 AGGGCTGAACAGATTAAGGAAGG + Intronic
1155078883 18:22388016-22388038 AATGGTTAACAGATGATGTGAGG - Intergenic
1158346624 18:56522829-56522851 AAGGGAGGACAGAAGAAGGAAGG - Intergenic
1158425539 18:57336948-57336970 ATGGGTTAACTGATGAATAAAGG - Intergenic
1158662438 18:59400777-59400799 AAGGGTTAACACATGAATTTAGG + Intergenic
1159431977 18:68363571-68363593 AATGGATGAGAGATGAAGGATGG + Intergenic
1162085902 19:8248974-8248996 ATGAATTAACAGATGAATGATGG + Intronic
1162146923 19:8618105-8618127 CAGTATTAAAAGATGAAGGAGGG - Intergenic
1165086369 19:33350936-33350958 AGGGGTGAGCAGCTGAAGGAAGG + Intergenic
1165717626 19:38056512-38056534 AGGGGTAAACTGACGAAGGATGG - Intronic
1167993504 19:53381751-53381773 AAGGGTTGACATATGACTGAAGG - Exonic
1167996593 19:53408811-53408833 AAGGGTTAACTGCTGATTGAAGG - Exonic
1168002109 19:53456180-53456202 AAGGGTTAACTGCTGATTGAAGG - Exonic
1168271874 19:55254557-55254579 AAGGGGTGACAGATGAAGCATGG - Intronic
1168442675 19:56383936-56383958 AAGGGGTAACTGCTGATGGAAGG + Exonic
925436964 2:3846820-3846842 AAGGGGGAGAAGATGAAGGAAGG + Intronic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
927422682 2:22949467-22949489 ATGACTTGACAGATGAAGGAAGG + Intergenic
928281201 2:29947816-29947838 AAGGGTTGTCTGATGGAGGAAGG - Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930135779 2:47904089-47904111 AATATTTAACAAATGAAGGAGGG - Intronic
930371012 2:50501192-50501214 AAGGGGAGACGGATGAAGGAAGG + Intronic
930982835 2:57548117-57548139 AAGGGAAAAAAGAGGAAGGAAGG + Intergenic
931326209 2:61227186-61227208 AAGTGTTATCAGAGGAAGAAGGG - Exonic
934733857 2:96677510-96677532 ATGGATTAACAAATGATGGATGG - Intergenic
936263604 2:110982430-110982452 AAGGGATGACAGAAGAAGAAGGG - Intronic
939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG + Intergenic
939523321 2:143260845-143260867 AATGGAGAACAGAGGAAGGATGG - Intronic
940714079 2:157198564-157198586 AAGGAAGAACAGAGGAAGGAAGG + Intergenic
943800590 2:192052755-192052777 AGGGGTTAAGAGAAGAAGAAAGG - Intronic
945000667 2:205346630-205346652 AAAGGTGACCATATGAAGGATGG - Intronic
947069349 2:226269463-226269485 ATGTGTTAATAGATGAAGGATGG - Intergenic
1169874549 20:10282599-10282621 AAGTGTAAACAGATGAGGGCTGG + Intronic
1169928233 20:10805280-10805302 AAGGGGTAACAGGTAAAGCAAGG - Intergenic
1169975955 20:11328232-11328254 AAGGGTGGAAAGATGAAGGAGGG + Intergenic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171156316 20:22877933-22877955 AATGGTGAACACAAGAAGGAGGG - Intergenic
1174082136 20:47978107-47978129 CAGGGCTAACAGATGAAGCATGG - Intergenic
1174134345 20:48368678-48368700 CAGGGCTAACAGATGAAGCATGG + Intergenic
1174530452 20:51208654-51208676 AAATGTTAACAGATGCATGAAGG + Intergenic
1174767329 20:53266248-53266270 AGGAGTAAAGAGATGAAGGAGGG + Intronic
1175566175 20:59979007-59979029 AGGGGTTAAGGGTTGAAGGAGGG - Intronic
1175934952 20:62510142-62510164 AAGGGTGAAGGGATGCAGGATGG - Intergenic
1177679656 21:24349526-24349548 AAGGGTTAAAAAATTAGGGAAGG + Intergenic
1178216907 21:30609022-30609044 AAGGGATAATAGAAGAAGAATGG + Intergenic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1182045456 22:27270711-27270733 AAGGGTAACCAGAGAAAGGAGGG + Intergenic
1182579863 22:31300446-31300468 AAGGAATAAGAGATGAAGAAGGG + Intergenic
1182845992 22:33431324-33431346 AAGGGTTGATGGATGAATGAAGG + Intronic
1183209834 22:36444074-36444096 AAGGTTTCAAAGATGGAGGATGG + Intergenic
1184023253 22:41834789-41834811 ATGGGTTAACAAATGGGGGATGG + Intronic
1185184011 22:49381770-49381792 AAGAGTTAACAGGAGAAGGAGGG - Intergenic
949273612 3:2251326-2251348 AAGGGTTACCAAATAAATGAAGG + Intronic
949694842 3:6682289-6682311 AAGAGGTAACATATGAAGCAAGG - Intergenic
951695791 3:25444377-25444399 AAGGGTTAACAAGTGAAAGCTGG + Intronic
951862837 3:27273027-27273049 CTGGGTTAACATCTGAAGGAAGG + Intronic
953544166 3:43850492-43850514 ATGGGTTAAAAGTTAAAGGATGG - Intergenic
955244807 3:57214890-57214912 AAGGGAATATAGATGAAGGAGGG + Intronic
955600797 3:60642842-60642864 AGGAGTTAACAAGTGAAGGAAGG - Intronic
956635948 3:71365283-71365305 AAGGGTTAAGAGATGAGTGCTGG + Intronic
957243054 3:77683912-77683934 AACGATCAACAGATGGAGGAAGG + Intergenic
957642688 3:82877631-82877653 AAGGAATGACAGAGGAAGGAAGG - Intergenic
958092657 3:88896038-88896060 AAGGGTGAACAGTAGAAGGGGGG - Intergenic
959462310 3:106642903-106642925 AATGGTTAAGAGATAAATGAAGG - Intergenic
959507706 3:107174449-107174471 AATGGTTACCAGATAAAAGAAGG + Intergenic
962070464 3:132028510-132028532 AAGGGGTAAGAGATGGGGGAAGG + Intronic
962936916 3:140089892-140089914 ATGGCTTAACAGTTAAAGGAAGG + Intronic
963263558 3:143216725-143216747 AAGGGAGAAATGATGAAGGAAGG - Intergenic
963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG + Intergenic
964348533 3:155779720-155779742 AAGAGTTAAAAGAAGTAGGATGG + Intronic
965368602 3:167830845-167830867 AAGGGAGAACAGATGAATGGTGG - Intergenic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
970801010 4:19973742-19973764 GAGGGATGAGAGATGAAGGAAGG + Intergenic
971384945 4:26133907-26133929 AAAGCTTTAAAGATGAAGGAAGG + Intergenic
974878492 4:67725271-67725293 AAGGGTGAAGAGATGAAAGAAGG - Intergenic
974938788 4:68439141-68439163 ATGGGAAAACAGATGAAGAAAGG + Intergenic
975818092 4:78240749-78240771 AAAGGGTACAAGATGAAGGATGG + Intronic
977751762 4:100617944-100617966 ACTGGGTAACAGATGAAGGCTGG - Intronic
977806800 4:101309175-101309197 AAGGGATGACAGAGGAAGGTGGG - Intronic
978501997 4:109419716-109419738 AAGGGGTAAGAGAGGAGGGAAGG - Intergenic
980300321 4:130982891-130982913 AAGGGTTAACAAATTAAATAAGG - Intergenic
980405269 4:132346386-132346408 GAGGGTTGAAAGAGGAAGGAGGG + Intergenic
981358177 4:143815768-143815790 AAGGGGTAATATATGAAGAAAGG - Intergenic
981369421 4:143941887-143941909 AAGGGGTAATATATGAAGAAAGG - Intergenic
981379163 4:144051829-144051851 AAGGGGTAATACATGAAGAAAGG - Intergenic
983187049 4:164712091-164712113 AAGGGTTAACAGATTAATCAAGG + Intergenic
986339548 5:6777430-6777452 CAGGGTTAAAAGATGCTGGAGGG + Intergenic
987079440 5:14413125-14413147 AAGAGTGTGCAGATGAAGGAAGG - Intronic
989067515 5:37479228-37479250 AAGATTTAACAGCTGAAAGAGGG + Intronic
989176210 5:38529075-38529097 AAGGGTAAACTGATGAAAGTGGG + Intronic
990339179 5:54805545-54805567 AAATGTTAACAGCTTAAGGAAGG + Intergenic
990875387 5:60478502-60478524 AATGTTTTAAAGATGAAGGAAGG - Intronic
992288575 5:75261416-75261438 AAAGGTTGACAGTTGGAGGAGGG - Intergenic
993421215 5:87702906-87702928 AAGAGTGAAAAGATGAAGGTTGG + Intergenic
993841236 5:92881693-92881715 AAATGGTAACAGATGATGGAGGG + Intergenic
994090610 5:95806628-95806650 AAAGGGTAACAGAGGATGGATGG - Intronic
995537087 5:113147514-113147536 GAGGGTTAACAAATTAATGATGG - Intronic
995784428 5:115814109-115814131 AAGAGTTAACCGATGACGAAGGG - Intronic
1000266835 5:159646260-159646282 AAAGGATAACAGATGAGAGATGG + Intergenic
1001123390 5:168997919-168997941 AAAGGTTATCACATGAAGAATGG - Intronic
1001206086 5:169764374-169764396 AAGGGTTTACTGGTTAAGGACGG + Intronic
1001253595 5:170167235-170167257 AAGGGGTAAGAGATGAAGTCAGG - Intergenic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1002359522 5:178659699-178659721 GTGGGTTATGAGATGAAGGATGG + Intergenic
1005126850 6:22456574-22456596 AAGGGTTAAAAGTAAAAGGATGG + Intergenic
1005717427 6:28563961-28563983 AAAGGCCAACAGATGGAGGAAGG + Intergenic
1005901094 6:30216800-30216822 AAGGGGCCTCAGATGAAGGAGGG - Intergenic
1008117108 6:47564532-47564554 AAGGGTTAAACAAAGAAGGAAGG - Intronic
1008350615 6:50485145-50485167 AAAGGTAAACAGATTAAAGAAGG + Intergenic
1008396436 6:51013075-51013097 AGGGGTTTGGAGATGAAGGAGGG - Intergenic
1010366201 6:75054767-75054789 AAGGATTAAGAGATGAGGAAGGG - Intergenic
1010485020 6:76400473-76400495 ATGGGTGAATAGATGAAGAATGG - Intergenic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1017622602 6:156314674-156314696 AAGGGTTAACAGAAGAGGACGGG - Intergenic
1017636012 6:156443928-156443950 AAGGATTAAAATATGATGGAAGG - Intergenic
1023335539 7:39165234-39165256 AAGGGTTAACAGATGAAGGAGGG - Intronic
1024139277 7:46445575-46445597 AAGGCTTATCATTTGAAGGAGGG - Intergenic
1024709651 7:52001132-52001154 AAGGGATGAAATATGAAGGAAGG + Intergenic
1025606880 7:63045815-63045837 AAGGATTGATAGATGATGGATGG - Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1030757186 7:113301320-113301342 AGGGTTGAACAGATGAAGCACGG - Intergenic
1030863488 7:114668342-114668364 AAGGGTTAAAATATGGAGTATGG - Intronic
1031960206 7:127982444-127982466 AAGGGATAAAAGAAGAATGAAGG - Intronic
1033281136 7:140007258-140007280 AAGTGGTAACTGATGGAGGAGGG - Intronic
1033455769 7:141502095-141502117 AGGGGATAACAGATGAAGCAAGG - Intergenic
1035279014 7:157765711-157765733 AAGGGTGAATGGATGAAGAATGG - Intronic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1035373548 7:158393945-158393967 AAGGGGTGAGAGATGAAGGGTGG - Intronic
1035878959 8:3222602-3222624 ATGGGTTAACAGTTGAAGCCAGG - Intronic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1039396623 8:37231473-37231495 AAGGAATAAGAGAGGAAGGAAGG + Intergenic
1039744487 8:40411938-40411960 AAGGGTTATGAGATAAAGGAGGG + Intergenic
1040658568 8:49542882-49542904 AATGGATAAGAGATGAAGGTGGG + Intronic
1041442280 8:57910153-57910175 AAGGACTGACAGATGAAGAATGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1043970213 8:86520246-86520268 TAGGTTTAACAGCTGAAGGCTGG + Intronic
1044449643 8:92319523-92319545 ATGGGATGACAGATGAATGATGG + Intergenic
1045116479 8:98988351-98988373 AAGGGTTAAGTGGAGAAGGATGG + Intergenic
1046564917 8:115886659-115886681 AAGGTTTAAAAGGTGAAGAATGG - Intergenic
1048237348 8:132703925-132703947 CATGGTTACAAGATGAAGGACGG + Intronic
1049853751 8:144848963-144848985 AAGGGTTCACAGATGAATTGAGG + Intronic
1050086025 9:1966617-1966639 AAGGGCTAACAGTTGGAGTAGGG - Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050572724 9:6958182-6958204 CAGAGTTAACAGGTGAAAGACGG - Intronic
1050831597 9:10020657-10020679 AAGAGTTTTCAGATGAAGCAAGG - Intronic
1050831694 9:10021781-10021803 AAGAGTTTTCAGATGAAGCAAGG - Intronic
1052210877 9:25901823-25901845 AAGGGGCTACAGAGGAAGGAAGG + Intergenic
1052280527 9:26728108-26728130 AAGCGTTAGCAGACGAAGTAAGG - Intergenic
1053863523 9:42412103-42412125 AATGATTAACTGATTAAGGAAGG - Intergenic
1056480671 9:87001441-87001463 TTGGGTTAAAAGAAGAAGGATGG - Intergenic
1057169077 9:92950056-92950078 ACAGGTGAACAGATGAAGGGAGG - Intronic
1059215791 9:112560919-112560941 AAGAATTCACAGATGAAGAAGGG - Intronic
1059385476 9:113960933-113960955 AAGGCTTCACCAATGAAGGAAGG - Intronic
1059498553 9:114730970-114730992 AAGGGTGAATGGATGATGGATGG - Intergenic
1059918468 9:119130869-119130891 AAGGCTTCATAGATGAAGAAGGG + Intergenic
1061093337 9:128439354-128439376 AAAGGTTAACAAATGAATGAAGG - Intergenic
1061417566 9:130455413-130455435 AACGGTGAATGGATGAAGGATGG - Intronic
1062125301 9:134857278-134857300 AGCGGTTTACAGATGAATGAGGG + Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1186434424 X:9530983-9531005 AAGGGTTAGCTGCTGACGGAGGG - Intronic
1186605955 X:11091727-11091749 CAGGGCTAAAAAATGAAGGAGGG - Intergenic
1186644911 X:11496030-11496052 AAGGCTCAACTGGTGAAGGAAGG - Intronic
1188179925 X:27042276-27042298 AAAAGTAAAGAGATGAAGGAAGG - Intergenic
1188362009 X:29266513-29266535 TAGGGTTAACAGATATATGATGG + Intronic
1188488523 X:30710332-30710354 CTAGGTTAGCAGATGAAGGAAGG - Intronic
1189011191 X:37047306-37047328 AATTGTTAAGAGATGGAGGAAGG - Intergenic
1189290614 X:39882962-39882984 AAGGGTTAAGAGAAGTCGGAGGG + Intergenic
1189496669 X:41514861-41514883 GAGGGTTAAAAGAAGAGGGATGG - Intergenic
1189827099 X:44930951-44930973 GAGGGTCAAAACATGAAGGAGGG - Intronic
1192701837 X:73482466-73482488 AAGGGTGAGCAGAAGAAGGGTGG - Intergenic
1193122316 X:77836409-77836431 AAGGGTAAATACTTGAAGGATGG + Intronic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1195666806 X:107439154-107439176 AAGGGTTAATAGTTGGAGAAGGG + Intergenic
1196909893 X:120474561-120474583 TGGGGTTAAGAGATGAAGGAGGG + Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1198381227 X:136085315-136085337 AAGGGCTAACATATGGAAGAGGG - Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1199138472 X:144281544-144281566 CAGGGTTAACAGATAAACGTTGG - Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201315814 Y:12644249-12644271 AAGGGCTATCAGATGAGGGCGGG - Intergenic