ID: 1023337190

View in Genome Browser
Species Human (GRCh38)
Location 7:39182850-39182872
Sequence AAGTGCCTATCGGACTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023337190 Original CRISPR AAGTGCCTATCGGACTCTGA TGG (reversed) Intronic
909944522 1:81648910-81648932 AAGTGTCCAAAGGACTCTGAAGG - Intronic
910293115 1:85617643-85617665 AAGGGCCTTTCTCACTCTGAAGG - Intergenic
918670954 1:187216163-187216185 AAGTCCCTGTCTGAGTCTGAAGG - Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1079633810 11:22711296-22711318 AAGTGCCTATGGGACTCTTCTGG - Intronic
1082631745 11:55550758-55550780 AACTGTCTATTGGACTCTCATGG + Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1090890130 11:130916072-130916094 CAGTGCCTGTAGGACTTTGAGGG - Exonic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1107889966 13:44905545-44905567 AAGTACCTCTCGGGGTCTGAAGG - Intergenic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1121627486 14:95396929-95396951 AAGTGCCTAGCAAACTGTGAAGG + Intergenic
1124715532 15:32057362-32057384 GGATGCCTATCTGACTCTGAAGG + Intronic
1131598609 15:93824730-93824752 CAGTGACTATGAGACTCTGAAGG + Intergenic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1146831476 17:36073081-36073103 AAGTCCCTGTCTGAGTCTGAAGG - Intergenic
1149910297 17:60560446-60560468 AAATGCCCATCTGACTCTGCTGG + Intergenic
1155229001 18:23755931-23755953 CAGTGCCAATGGGACTCAGATGG + Intronic
1159795605 18:72839517-72839539 AAGTGCCTAAAGGACTCCTAAGG + Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
927737031 2:25533540-25533562 AAGTGACTATCAGCCTTTGATGG - Intronic
930224294 2:48776749-48776771 AAGTTGCTATCAGACCCTGATGG - Intergenic
931276215 2:60746059-60746081 AAATGCCCATCTGACTCTGCCGG + Intergenic
932035704 2:68244788-68244810 AGGTGCTTATCGGACATTGAAGG - Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
933308899 2:80636451-80636473 AAGTGCCTACCAAACACTGAAGG - Intronic
935763305 2:106341710-106341732 AAGCCCCTAAGGGACTCTGATGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172211173 20:33199571-33199593 AAGAGCCTTTCCAACTCTGATGG + Intergenic
1176809730 21:13525445-13525467 CAGTGCCTATAGGACTTAGAGGG + Intergenic
956297266 3:67728240-67728262 AAGTTCCTATGAGACTCTGGTGG + Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
960211603 3:114974372-114974394 AATTGCCTTTGGGACTCTGAAGG - Intronic
960949437 3:122989521-122989543 AAGGGCCTCTGGGGCTCTGAAGG + Intronic
969725057 4:8913842-8913864 AAGGGCCTGCCTGACTCTGATGG - Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
976489995 4:85659328-85659350 AAGTGCCTATCAGATTTTCAAGG + Intronic
976811475 4:89105175-89105197 AAATGCCCATCTGACTCTGCTGG - Intronic
977558274 4:98506564-98506586 AAATGCCTACTGGCCTCTGAGGG + Intronic
985025055 4:185732458-185732480 AAGTGCCTATGTGACTGTGAGGG + Intronic
987693304 5:21296554-21296576 AAGTGCCTATTGGACAGAGATGG + Intergenic
987748711 5:22010799-22010821 ATGTGCCTATCCCACTCTGCCGG + Intronic
991746974 5:69753002-69753024 AAGTGCCTATTGGACAGAGATGG - Intergenic
991750731 5:69802240-69802262 AAGTGCCTATTGGACAGAGATGG + Intergenic
991798575 5:70332944-70332966 AAGTGCCTATTGGACAGAGATGG - Intergenic
991826350 5:70628314-70628336 AAGTGCCTATTGGACAGAGATGG - Intergenic
991830021 5:70677137-70677159 AAGTGCCTATTGGACAGAGATGG + Intergenic
991890906 5:71332267-71332289 AAGTGCCTATTGGACAGAGATGG - Intergenic
993534024 5:89058815-89058837 CAGTGCCTATTAGACTCTCAGGG + Intergenic
993544259 5:89191550-89191572 AACTGCCTGTCGGACTAAGATGG + Intergenic
993720296 5:91315392-91315414 AAGTTCCTATAGGACCCTAATGG - Intergenic
1005696468 6:28356690-28356712 AAATGCCCATCTGACTCTGTTGG + Intronic
1010290485 6:74130957-74130979 AAGTGAATATCTGACTCTGCAGG - Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1023337190 7:39182850-39182872 AAGTGCCTATCGGACTCTGATGG - Intronic
1026610959 7:71859468-71859490 AAGTTCCTAGAGGCCTCTGACGG - Intronic
1028018744 7:85745231-85745253 AATTGCCTATCTGTCTCTGAAGG + Intergenic
1028723218 7:94057945-94057967 AAGTTCCAATCTGAGTCTGAAGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1032488607 7:132307064-132307086 CAGTTCCCATCAGACTCTGATGG + Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037322970 8:17661154-17661176 AAGTAACTTTCCGACTCTGAAGG + Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039360429 8:36870902-36870924 AAGTGCCAATGGGACTCTTGGGG - Intronic
1048342659 8:133552747-133552769 AAGTGCCTTTCTGAATTTGAAGG + Intronic
1050797268 9:9560404-9560426 AAATGCCTATCCGACTTTGCTGG + Intronic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1058061666 9:100503684-100503706 AAGTCCCTATCTGAGACTGAAGG + Intronic
1059575161 9:115480077-115480099 TAGTCCCAATCCGACTCTGAAGG + Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1188446341 X:30256732-30256754 AAGGGCGTATCGGACCCTCAGGG - Intergenic
1195437094 X:104857164-104857186 AAATACCTATTGGACTCTGGAGG + Intronic
1197730451 X:129805153-129805175 AAGTGGCTCTGGGACTCTGCCGG + Exonic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic