ID: 1023337285

View in Genome Browser
Species Human (GRCh38)
Location 7:39183573-39183595
Sequence TATAATCCCCAATGTGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023337285_1023337290 0 Left 1023337285 7:39183573-39183595 CCTCTTCCACATTGGGGATTATA 0: 1
1: 0
2: 9
3: 52
4: 290
Right 1023337290 7:39183596-39183618 ACTGGACATGAGATTTGGGCAGG 0: 10
1: 54
2: 421
3: 1983
4: 6608
1023337285_1023337288 -5 Left 1023337285 7:39183573-39183595 CCTCTTCCACATTGGGGATTATA 0: 1
1: 0
2: 9
3: 52
4: 290
Right 1023337288 7:39183591-39183613 TTATAACTGGACATGAGATTTGG 0: 2
1: 36
2: 310
3: 2060
4: 5566
1023337285_1023337289 -4 Left 1023337285 7:39183573-39183595 CCTCTTCCACATTGGGGATTATA 0: 1
1: 0
2: 9
3: 52
4: 290
Right 1023337289 7:39183592-39183614 TATAACTGGACATGAGATTTGGG 0: 2
1: 38
2: 282
3: 1929
4: 6189
1023337285_1023337291 1 Left 1023337285 7:39183573-39183595 CCTCTTCCACATTGGGGATTATA 0: 1
1: 0
2: 9
3: 52
4: 290
Right 1023337291 7:39183597-39183619 CTGGACATGAGATTTGGGCAGGG 0: 10
1: 32
2: 296
3: 1125
4: 3932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023337285 Original CRISPR TATAATCCCCAATGTGGAAG AGG (reversed) Intronic
901178080 1:7319276-7319298 TGTAATCCCCAGTGTTGGAGAGG + Intronic
907933582 1:59022104-59022126 TATAAGCCCCATGGTGGCAGGGG - Intergenic
907984643 1:59518515-59518537 TGTAATCCCCAGTGTTGGAGGGG + Intronic
908675489 1:66598810-66598832 TGTAATCCCCAGTGTTGGAGAGG - Intronic
909022743 1:70450174-70450196 TATAATCCCCATTTTGGTGGGGG + Intergenic
909369851 1:74870949-74870971 TGTAATCCCCAATGTTGGAGGGG + Intergenic
909825452 1:80120943-80120965 TACACTCCACAGTGTGGAAGCGG + Intergenic
909926832 1:81447817-81447839 TGTAATCCCCAATGTTGGAGTGG + Intronic
910613958 1:89176838-89176860 TATTATCCCCATTGTCCAAGGGG + Intergenic
911302393 1:96191556-96191578 TATAATCCCCAATGGTGGAGGGG + Intergenic
913348281 1:117829689-117829711 TATAATCTCCAATGTTGGAAGGG + Intergenic
915794432 1:158713377-158713399 TATAATCCCCAGTGTCTATGGGG + Intergenic
917100282 1:171438234-171438256 TATAATCCCCATGTTGGAGGTGG - Intergenic
917466216 1:175278741-175278763 AATTATGCCCACTGTGGAAGGGG + Intergenic
917561173 1:176157959-176157981 TGGAATTCCCAAAGTGGAAGAGG + Intronic
918293781 1:183135678-183135700 TATATTCCCCAGTGAGGAACTGG - Intronic
918930880 1:190855593-190855615 TGTAATTCCCAAACTGGAAGTGG + Intergenic
919207171 1:194432336-194432358 TATAATCTACAATGTAGAAAAGG + Intergenic
921637338 1:217512066-217512088 TGTAATCCCAGAGGTGGAAGTGG + Intronic
922898636 1:229119510-229119532 TACACTCCACAATGTGGGAGTGG - Intergenic
923698321 1:236276867-236276889 TATAATCCCCAGTGTTGGGGAGG + Intronic
923898918 1:238304370-238304392 TGTAATTCCCAATGTTGGAGTGG + Intergenic
924295729 1:242585492-242585514 TACACTCCACAGTGTGGAAGCGG - Intergenic
924369911 1:243336678-243336700 TGTAATCCCCGATGTTGGAGGGG - Intronic
1063323068 10:5070394-5070416 TACACTCCACATTGTGGAAGTGG + Intronic
1063556926 10:7089187-7089209 TGTAATCCCCAATGCAGGAGGGG - Intergenic
1063733433 10:8724789-8724811 TGTAATCCCCAATGTTGGAGGGG + Intergenic
1065176937 10:23086653-23086675 TGTAATCCCCAGTGTGGGACTGG - Intergenic
1065291401 10:24233405-24233427 TTTGATCCCCAAAGTTGAAGGGG - Intronic
1065319580 10:24496873-24496895 TATATTTCCCAAAGTGGAATCGG + Intronic
1065619523 10:27566185-27566207 CTTGATCCCCAATGTGGAGGTGG - Intergenic
1068489059 10:57698839-57698861 TATAATCCTGAATGTTGGAGAGG - Intergenic
1070330075 10:75410024-75410046 TATATTCCCCACTGTCCAAGAGG - Intergenic
1071394598 10:85209085-85209107 TATAATCCCCAGTGTTGAAGGGG - Intergenic
1072277244 10:93835153-93835175 TGTAATCCCCAAGTTGGAGGTGG - Intergenic
1072991041 10:100194076-100194098 TCTACTCCCTAAGGTGGAAGTGG - Exonic
1073639113 10:105231052-105231074 GAGATTCCCCAATGTGGAAAGGG - Intronic
1073824075 10:107300257-107300279 TATAATTGGCAAAGTGGAAGTGG - Intergenic
1074737751 10:116453525-116453547 TGTCATCCCCAATTTGGAAATGG + Intronic
1075079642 10:119374719-119374741 TGTAATCCCTAATGTTGAGGTGG + Intronic
1075918771 10:126192092-126192114 TGTAATCCCCAACTTGGAGGTGG - Intronic
1079303811 11:19304617-19304639 TATAACCCCCAATATTGGAGTGG - Intergenic
1079585181 11:22116814-22116836 TGTAATCCCCAGTGTTGGAGGGG - Intergenic
1080595056 11:33765650-33765672 TGTAATCCCCAATATTGGAGGGG + Intronic
1081449222 11:43156442-43156464 TATTATCCCCAATATAGCAGTGG + Intergenic
1083417272 11:62533825-62533847 TGAAATCTCCAATGTGGATGTGG - Exonic
1085939748 11:81195166-81195188 TGTAATCCCTAATGTTGGAGGGG + Intergenic
1087708665 11:101524153-101524175 TATAATCCCAAATTTGAAAATGG - Intronic
1088090853 11:106037892-106037914 TATAATCCCCTGTGTTGGAGGGG + Intergenic
1091873887 12:3917798-3917820 TCTCATCCCCAAGGTGGACGTGG + Intergenic
1092305134 12:7292503-7292525 TATAATCCCCAGTTTGGAAGAGG - Intergenic
1093457936 12:19382913-19382935 TTTAATTCTCAATGTGGCAGGGG - Intergenic
1093988762 12:25567526-25567548 TGTAATCCCCAGTGTGGATGAGG + Intronic
1094030570 12:26007246-26007268 TTTGATCCCCAGTGTGGCAGTGG - Intronic
1094762036 12:33544998-33545020 TGCAATCCCCAGTGTTGAAGTGG - Intergenic
1095618390 12:44220355-44220377 TATAATCAACAATGTGGTACTGG + Intronic
1097236651 12:57544993-57545015 TTGACTCCCCCATGTGGAAGTGG - Intronic
1097435860 12:59551355-59551377 TATTACTCCCAATGTGGCAGGGG + Intergenic
1097623397 12:61969515-61969537 TATATTCCTCATTGTGTAAGAGG + Intronic
1097721503 12:63026408-63026430 TATGATACACCATGTGGAAGAGG + Intergenic
1097861003 12:64518558-64518580 TGTAATCCCCAATGTGGGGATGG - Intergenic
1098827768 12:75319258-75319280 TTTAATCCCCAATGTTGGAGTGG + Intronic
1099138844 12:78943567-78943589 TATAATCCCCAGTGTTAAAGAGG - Intronic
1100802141 12:98243096-98243118 TAAAATACCCAATGTGTTAGGGG - Intergenic
1103147886 12:118611131-118611153 TGTAATCCCCAAGAGGGAAGAGG + Intergenic
1103493610 12:121343728-121343750 TGTAATCCCCAGGGTGGCAGGGG - Intronic
1104370045 12:128216397-128216419 TGTAATCCCCAGTGTTGAGGTGG + Intergenic
1104519255 12:129457865-129457887 TGTAATCCCCAGTGTTGGAGGGG - Intronic
1105833056 13:24182649-24182671 TGTGATCCCCAGTGTTGAAGCGG - Intronic
1106383890 13:29265847-29265869 TGTAATCCCCAGTGTGGAGGTGG - Intronic
1106733931 13:32570328-32570350 TGTAATCCCCAATGCTGCAGTGG - Intergenic
1108092071 13:46859485-46859507 TATAATCTCCAATGTGGAGGTGG + Intronic
1108981939 13:56524811-56524833 TATAATCCCCAGTGTTGGGGAGG - Intergenic
1109311935 13:60705322-60705344 TAGAATCCCCAAAGTTGATGTGG + Intergenic
1110556273 13:76863298-76863320 TGTAATCCCCAGTGTTGAGGTGG + Intergenic
1111422195 13:88027029-88027051 TGTAATCCCCAGTGTGGAAAAGG + Intergenic
1112637601 13:101232984-101233006 TCAAATCACCAATGTGGAAGTGG - Intronic
1114436481 14:22711397-22711419 TATTATTCCCAATGTTGCAGGGG + Intergenic
1114436602 14:22712144-22712166 TATTATTCCCAATGTCGCAGGGG + Intergenic
1114598575 14:23935151-23935173 TGTGATCCCCAGTGTGGAGGTGG - Intergenic
1116397299 14:44462039-44462061 TACACTCCACAATGTGGGAGCGG - Intergenic
1116726514 14:48567026-48567048 TACACTCCACACTGTGGAAGCGG + Intergenic
1116907537 14:50419112-50419134 TATCATCCCTAATGTAGCAGGGG - Exonic
1117125624 14:52620944-52620966 TATCATCCCCAAAGGGAAAGAGG + Intronic
1120056696 14:79932744-79932766 TATAATCTCCAATTTGTATGTGG + Intergenic
1120957715 14:90097522-90097544 TTTGATCCCCAATGTGGTGGTGG - Intronic
1122866522 14:104607455-104607477 CTTAATCCCCAATGTGACAGTGG + Intergenic
1123152430 14:106196157-106196179 TATAATCCTCAATTGTGAAGGGG + Intergenic
1123172593 14:106388855-106388877 TATAATCCCCAGTTGTGAAGGGG + Intergenic
1124445091 15:29723249-29723271 TATAATCCTCAGTGTTGGAGTGG + Intronic
1124661145 15:31551967-31551989 TGTGATCCCCAATGTTGAGGGGG + Intronic
1125281606 15:38047680-38047702 TATAATCCCCATGTTGGAGGAGG - Intergenic
1126127802 15:45311886-45311908 TGTAATCCCCAGTGTTGGAGGGG + Intergenic
1126762968 15:51986274-51986296 TGTAATCCCCAATGTTGGCGGGG - Intronic
1127516141 15:59695113-59695135 TATAATGAGCAATGTGGAAAAGG + Intergenic
1128467487 15:67925046-67925068 TGTAATCCCCAATGTTGGAGGGG - Intergenic
1129134695 15:73537125-73537147 TATAAGCCCCAAGAGGGAAGGGG - Intronic
1129817521 15:78567774-78567796 TATAATTTTCAAGGTGGAAGGGG - Intronic
1130997672 15:88912880-88912902 TAGAATCTCCCAGGTGGAAGGGG + Intronic
1133296411 16:4754819-4754841 TGTAATCCCCAATGTGGAGGTGG + Intronic
1135149229 16:19990840-19990862 TATAGTCCCAAATATGCAAGTGG - Intergenic
1138071028 16:53993274-53993296 TATATTCCTAAATGTGAAAGAGG + Intronic
1138230979 16:55335961-55335983 TGTAATCCCCAATTTTGAGGTGG - Intergenic
1139041746 16:63006289-63006311 TGTAATCTCCAATGTGAAGGTGG - Intergenic
1143244003 17:5468083-5468105 TATGATCCCCAACGTGTTAGAGG - Intronic
1143251662 17:5527522-5527544 TAGAATCCCAACTCTGGAAGAGG + Intronic
1143988181 17:10933513-10933535 TGTAATCCCCAATATGTTAGAGG - Intergenic
1145125549 17:20297134-20297156 GATAAACCCCACTGTGGGAGGGG + Intronic
1147463795 17:40594517-40594539 TATAATCCCAAATTTGGAGGTGG + Intergenic
1149574486 17:57702084-57702106 AATACACCCCCATGTGGAAGCGG + Intergenic
1150642562 17:66959360-66959382 TTTTATCCCCATTGTGTAAGTGG - Intergenic
1152088815 17:78236033-78236055 GATAATCCCCAGTGTTGGAGGGG - Intronic
1153000402 18:450297-450319 TGTAATCCCCAATGTTGAGGGGG + Intronic
1153082994 18:1249967-1249989 TGTAATCCCCAATGAAGACGGGG - Intergenic
1153168775 18:2292108-2292130 TATACTCCACAGTGTGGTAGTGG - Intergenic
1155854631 18:30817410-30817432 AAAGATCTCCAATGTGGAAGAGG + Intergenic
1155887700 18:31228102-31228124 TATAAGCCACAATTTGGAAAAGG + Intergenic
1156807052 18:41197376-41197398 TGTAATCCCCAATTTGGATGAGG + Intergenic
1157751603 18:50183721-50183743 TTTGATCCCCAATGTGGCGGGGG + Intronic
1157815374 18:50726086-50726108 TCTCATCCTCAATGCGGAAGGGG - Exonic
1158333037 18:56383971-56383993 GTTAATCCCAAATCTGGAAGGGG + Intergenic
1158624028 18:59056507-59056529 TGTAATCCCCAGTGTTGAAGTGG - Intergenic
1159319807 18:66831688-66831710 TATAATCCCCATGTTGGAGGTGG - Intergenic
1159898626 18:74021203-74021225 TATAATCCCCAATGTTGAGGTGG - Intergenic
1160124859 18:76162610-76162632 TGTAATCCCCAGTGTTGAGGAGG - Intergenic
1160245508 18:77155759-77155781 TGTAATCCCCAGCGTGGGAGTGG + Intergenic
1165147755 19:33742581-33742603 TGAAATCCCCAATGTAGAGGTGG - Intronic
1165155874 19:33787188-33787210 TGTAATCCCCAGTGTTGGAGGGG + Intergenic
1168582549 19:57567649-57567671 TATAATGGCAAGTGTGGAAGGGG - Intergenic
925690208 2:6514620-6514642 TATAATCCCCAGTGTTGGTGGGG - Intergenic
927033655 2:19149927-19149949 TGTAATCCCCAATGTTGTAGGGG - Intergenic
927062184 2:19434007-19434029 TATAATCTCCAATATTGGAGGGG + Intergenic
930310152 2:49730199-49730221 TTTAATCCCAAATGAGGTAGAGG - Intergenic
931289818 2:60862460-60862482 TGTAATCCCCAGTGTTGAAGGGG - Intergenic
931489759 2:62732426-62732448 TGTAATCCCCAATTTGGAGGTGG + Intronic
931631918 2:64309827-64309849 TAAAAGCCCCAACTTGGAAGCGG + Intergenic
934046097 2:88173645-88173667 TAAAATCCCTAGTGTTGAAGAGG - Intronic
934492641 2:94772039-94772061 TGTAATCCCTAATGTTGAAGCGG - Intergenic
934507457 2:94905367-94905389 TATTATTCCCAATGTTGCAGTGG + Intergenic
935931791 2:108134428-108134450 TGTAATCCCCAGTGTTGGAGGGG - Intergenic
936100218 2:109570962-109570984 TGTAATCCCCAGTGTTGGAGGGG + Intronic
936629041 2:114180513-114180535 TTTGATCCCCAATGTGTCAGTGG + Intergenic
937296528 2:120812861-120812883 AAGCATCCCCCATGTGGAAGAGG - Intronic
938844455 2:135194492-135194514 TGTAATCCTCAATCTGGAGGTGG - Intronic
939400516 2:141686699-141686721 CTTCATCCCCAATGTGGCAGAGG + Intronic
940064079 2:149607355-149607377 TATAATCCCCATGATGGAGGTGG - Intergenic
940086155 2:149861330-149861352 AATAATCCCCAGTGTCGGAGTGG - Intergenic
940403207 2:153269946-153269968 TGTAATCCCCAATGTGTCAAGGG - Intergenic
940646664 2:156399279-156399301 TATAATACGCAATGTCCAAGAGG - Intergenic
941533118 2:166693423-166693445 TATTATTCCCAATATCGAAGGGG - Intergenic
941672758 2:168312219-168312241 TAAAAGCCACACTGTGGAAGGGG - Intergenic
942203122 2:173592305-173592327 TGTAATCCCCAGTGTTGAAGGGG - Intergenic
943154108 2:184150657-184150679 TGTAATCCCCAATGTGGGGAGGG - Intergenic
943603122 2:189944178-189944200 TGTAATCCCCAATGCTGGAGCGG + Intronic
944188668 2:196978109-196978131 TATAATCCCCAATGTTAGAGGGG + Intronic
945315993 2:208371126-208371148 TACAATCCCCAAGTTGGAGGTGG - Intronic
945617376 2:212089442-212089464 TGTAACCCCCAATGTTGGAGGGG + Intronic
946101637 2:217330295-217330317 TACACTCCACAGTGTGGAAGCGG + Intronic
946746298 2:222849078-222849100 TTTAAGCTCCAATGAGGAAGTGG - Intergenic
947998058 2:234545021-234545043 AAGGATCCCCAGTGTGGAAGCGG + Intergenic
948105674 2:235411872-235411894 TGTAATCCCCAATGCTGGAGGGG + Intergenic
1169765116 20:9140522-9140544 TATGATCCCGAATGTTGGAGGGG + Intronic
1170998919 20:21394546-21394568 TAAAATCTCAAATGTAGAAGAGG + Intergenic
1174975281 20:55326136-55326158 TATTATCCCCAATTTATAAGTGG - Intergenic
1176961359 21:15162800-15162822 TATGACCCCCAATGTGAAGGAGG - Intergenic
1176963631 21:15187764-15187786 TGTAATCCCCAGTGTGGAGGTGG - Intergenic
1179155161 21:38843600-38843622 TGTAATCCCCAATGTTGGAGCGG - Intergenic
1183116751 22:35698123-35698145 TATTATCCCCAATATCGCAGGGG - Intergenic
1183274080 22:36880613-36880635 TATAATCCCCAGGTTGAAAGTGG + Intergenic
1183462641 22:37961500-37961522 TATTCTCCCAAATGTGGGAGAGG - Intronic
1183594285 22:38800785-38800807 TATAATCCCCAGTGTTGCAGGGG + Intergenic
1184842050 22:47057864-47057886 TATAAACCCCCATGGGGCAGGGG - Intronic
1185209723 22:49563898-49563920 TGTAATCCCCAGTGTTGGAGAGG - Intronic
949494805 3:4621471-4621493 TGTAATCCCCAGTTTGGAGGTGG - Intronic
951457682 3:22910929-22910951 TGTAATCTCCAATGTTGGAGGGG + Intergenic
952669551 3:35949694-35949716 TGCAATCCCCAATGTTGGAGGGG + Intergenic
954022237 3:47752367-47752389 TATAAACCCCCATGCTGAAGAGG + Intronic
954231459 3:49220924-49220946 AATCTTCCACAATGTGGAAGGGG + Intronic
955416038 3:58691863-58691885 TACACTCCACAATGTGGGAGAGG - Intergenic
956877324 3:73476464-73476486 TGTAAACCCCAATGTTGAAGGGG - Intronic
957610099 3:82454624-82454646 TATATTTCAAAATGTGGAAGTGG + Intergenic
957909846 3:86606983-86607005 TGTAATCCCCAATGTTCAGGTGG - Intergenic
958745568 3:98129478-98129500 TCCAATCCCCAATGTTGGAGAGG - Intergenic
958748381 3:98164840-98164862 TCCAATCCCCAATGTTGGAGAGG - Intergenic
959149319 3:102590045-102590067 TGTAATCCCCAATGTGGAGGAGG + Intergenic
959171688 3:102851994-102852016 TGTAATCCTCAATGTTGGAGGGG + Intergenic
959316353 3:104812622-104812644 TATAATACCCATTATGAAAGAGG + Intergenic
959557336 3:107736702-107736724 TATAATTCAGATTGTGGAAGGGG + Intronic
959804404 3:110533618-110533640 TGTAATCCCCAATGTTGGAGGGG + Intergenic
961348011 3:126277314-126277336 TGTAATCCCCAGTGTTGGAGGGG - Intergenic
963770962 3:149385756-149385778 TACACTCCACAGTGTGGAAGTGG + Intergenic
963834144 3:150039116-150039138 TACACTCCCCAGTGTGGGAGTGG - Intronic
964731947 3:159876957-159876979 AATAATCCCCAAGGAGGAGGTGG - Intronic
965534934 3:169813720-169813742 TATACTCCACAGTGTGGGAGTGG - Intergenic
966385466 3:179393055-179393077 TTTCTTCCCCACTGTGGAAGAGG + Exonic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
970020963 4:11568086-11568108 TGTAATCCCCAATGTCGGAGTGG - Intergenic
970279727 4:14441588-14441610 TTTAATCCCCAATGCTGGAGGGG + Intergenic
970344261 4:15137933-15137955 TGTAATCCCCCATGTTGGAGAGG + Intergenic
970573763 4:17407664-17407686 TATAAGCCCCAAGGTGGAGTGGG + Intergenic
970747098 4:19312314-19312336 TGTAATCCCCATTGTTGGAGAGG + Intergenic
971848869 4:31957895-31957917 TGTAATCCCCAGTGTTGAAGAGG + Intergenic
972011492 4:34189096-34189118 TGTCATCCTCAATGTTGAAGTGG + Intergenic
972897941 4:43645877-43645899 TGTAATCCCCAGTGTTGGAGTGG - Intergenic
975199118 4:71565058-71565080 TATACTCCACAGTGTGGGAGTGG + Intronic
976885448 4:89978105-89978127 TATAATCCCCAAAAGGGCAGGGG - Intergenic
977664405 4:99628956-99628978 TATAATACCCATTTTGGAAATGG - Intergenic
979180441 4:117720355-117720377 TGTAATCTCCAATGTGGAGTGGG + Intergenic
980038959 4:127916750-127916772 TATATGCCCCACTGTGGAAATGG - Intergenic
980105277 4:128582638-128582660 TATAATGCCAAATGGGTAAGAGG - Intergenic
981460901 4:145012856-145012878 TGTAATCCCCAATGATGGAGGGG + Intronic
981502720 4:145469764-145469786 TATAATCAACAATGAGGGAGAGG + Intergenic
981698268 4:147580705-147580727 TGTAATCCTCAATGTTGAGGTGG - Intergenic
982330675 4:154178715-154178737 TGTAATCCCCAGTGTTGGAGGGG + Intergenic
982666498 4:158270861-158270883 TGTAATCCCCCATGTTGGAGGGG + Intergenic
983084828 4:163429901-163429923 TATAATCCCCAGTGTTGGAGGGG - Intergenic
983623851 4:169785604-169785626 TATAATAGCCAAGGTGGGAGAGG + Intergenic
983624654 4:169790416-169790438 TATAACTCCCAGTGTTGAAGGGG - Intergenic
984138438 4:175971570-175971592 TATATTACCCTATTTGGAAGCGG + Intronic
987605309 5:20127071-20127093 TGCAATCCCCAATGTGGAGAAGG + Intronic
987870836 5:23614719-23614741 TACACTCCACAGTGTGGAAGTGG + Intergenic
988671575 5:33387296-33387318 TGTAATCCACATTGTTGAAGTGG - Intergenic
989180549 5:38572452-38572474 TATAATCCCTAATGTTGCAGTGG - Intronic
989458499 5:41669248-41669270 GATAATTACCAATTTGGAAGAGG - Intergenic
989497314 5:42124344-42124366 TGTAATTCCCAATGTTGGAGGGG - Intergenic
989752770 5:44915782-44915804 TTTGATCCCCAATGTTGGAGGGG + Intergenic
989782177 5:45281176-45281198 TGTAATCCTCAGTGTTGAAGAGG + Intronic
990688344 5:58333873-58333895 TATAATGTTCAATGTGTAAGAGG + Intergenic
990955608 5:61335151-61335173 AATAGTCCCCAAAGGGGAAGAGG + Intronic
991340165 5:65600208-65600230 TGTAATCCCCAATGTTGAAATGG - Intronic
992271160 5:75064035-75064057 CTTAATCCCCAATGTAGCAGTGG - Intergenic
992313623 5:75529421-75529443 TGTGATCCCCAATGTTGGAGTGG - Intronic
992473996 5:77084648-77084670 CATAATCTCCACTGGGGAAGGGG + Intronic
992647358 5:78823937-78823959 TGTGATCCCCAATGTTGGAGGGG + Intronic
992839658 5:80675630-80675652 TGTAATCCCCAATGCTGAGGGGG - Intronic
994575871 5:101578800-101578822 TATGATCCACATTGGGGAAGAGG + Intergenic
994740025 5:103606281-103606303 TGTAATCCCTAATTTGGAGGTGG - Intergenic
996071378 5:119135916-119135938 GATAACCCAAAATGTGGAAGCGG + Intronic
996565479 5:124875691-124875713 TTTCTTCCCCACTGTGGAAGAGG - Intergenic
996596122 5:125204559-125204581 TATACTCCACAGTGTGGGAGCGG - Intergenic
996602173 5:125277250-125277272 TGTAATCCCCAATGTTGGAGAGG + Intergenic
996635944 5:125690636-125690658 CATAATCCCCAATGTGTCATGGG + Intergenic
996911037 5:128656702-128656724 TGTAATCCCCAATGTTGGAGAGG - Intronic
997110094 5:131065469-131065491 TGTAATCCCCAGTGTTGGAGGGG + Intergenic
997687717 5:135800343-135800365 TATTATTCCCAATATCGAAGGGG + Intergenic
998936186 5:147233257-147233279 TATTATGCCCAATGTCGCAGGGG + Intergenic
999162707 5:149517851-149517873 TAGAATCTCCAGTGGGGAAGAGG - Exonic
999838269 5:155397873-155397895 TGTAATCCCCAATGTAGGTGGGG - Intergenic
1000815219 5:165912766-165912788 TGTAATCCCCAATGTTGAAGGGG - Intergenic
1001167029 5:169378531-169378553 TATAATCCACCATGATGAAGTGG + Intergenic
1002291129 5:178201628-178201650 AACAATCCCCAATGTGGAGTTGG + Intergenic
1005516945 6:26564093-26564115 TATACTCCACAGTGTGGGAGTGG - Intergenic
1005884671 6:30087828-30087850 TATTCTCCCCGATGGGGAAGTGG - Intergenic
1007182290 6:39938197-39938219 TTTGATCCCCAGTGTGGCAGTGG + Intergenic
1008342887 6:50388961-50388983 TTTAATCGCCAAAGTGGAAAAGG - Intergenic
1008750980 6:54733489-54733511 TGTAATCCCCAATGTTGGAGAGG - Intergenic
1009226555 6:61025140-61025162 TATCATTCCCAATATTGAAGGGG + Intergenic
1009380116 6:63017183-63017205 TGTAATCCCCAATGTTGGAGGGG + Intergenic
1009460938 6:63912624-63912646 TGTAATCCCCAATGTTGGAGGGG + Intronic
1009652958 6:66499738-66499760 TGTAATCCCCATTGTGGAAGTGG + Intergenic
1011727787 6:90228376-90228398 TATAATGCATTATGTGGAAGAGG + Intronic
1011998505 6:93623307-93623329 TGTAATCCCCAATGTTGGAGGGG + Intergenic
1012125420 6:95421988-95422010 TGTAATCCCCAATGTTGGGGTGG - Intergenic
1012789855 6:103679099-103679121 TTTAATCTCCTTTGTGGAAGAGG + Intergenic
1014547846 6:122753707-122753729 TACACTCCACAGTGTGGAAGTGG + Intergenic
1014687358 6:124518653-124518675 TGTAATCCCCAATGCTGGAGGGG - Intronic
1017972220 6:159322665-159322687 TATTATCTCCAGTTTGGAAGAGG - Intergenic
1018529038 6:164743504-164743526 TAACATGCCCAATGTGAAAGGGG + Intergenic
1019924083 7:4180881-4180903 TATAATCCCCAACGTGCAGGTGG - Intronic
1020501355 7:8925344-8925366 CTTAATCCCCAATGTGGTAGAGG - Intergenic
1020516552 7:9128408-9128430 GGTAATCCCCAATTTTGAAGAGG + Intergenic
1021220249 7:17967337-17967359 TATAATTCCTAATAAGGAAGTGG - Intergenic
1022033126 7:26510271-26510293 TATAATCCCCATGTTGGAGGAGG + Intergenic
1022292179 7:29015343-29015365 GGTAATCCCCAATTTGGAGGTGG + Intronic
1022385581 7:29895856-29895878 TGTAATCCCCAATTTAGAGGTGG - Intronic
1022601870 7:31768429-31768451 TCCAATCCCCAATGTTGCAGCGG - Intronic
1023337285 7:39183573-39183595 TATAATCCCCAATGTGGAAGAGG - Intronic
1023345893 7:39270927-39270949 TAGAATCCTCAAGGCGGAAGGGG - Intronic
1024300860 7:47886481-47886503 TATAATCCCCAGTGTTGGAGGGG + Intronic
1025750612 7:64290705-64290727 TATAATCCCTTATGTAGAAAGGG + Intergenic
1026528607 7:71177243-71177265 CCTATTCCCCAAGGTGGAAGGGG - Intronic
1026651830 7:72222557-72222579 TGTAATCCCCAGTGTTGGAGGGG - Intronic
1029234180 7:99099584-99099606 TTTGATCCCCACTGTGGCAGCGG + Intronic
1029343285 7:99961377-99961399 TATTACTCCCAATGTCGAAGGGG + Intergenic
1029343553 7:99962997-99963019 TATTACCCCCAATATTGAAGGGG + Intergenic
1030777637 7:113553848-113553870 TGTGATCCCCAATGTTGCAGGGG - Intergenic
1031353054 7:120759146-120759168 TATAATCCACAAGGTAGAAAAGG + Intergenic
1031713187 7:125075131-125075153 TATAATCTCCAGTGTTGAAAAGG + Intergenic
1031713318 7:125076050-125076072 TGTAATCCTCATTGTTGAAGGGG + Intergenic
1031884990 7:127237036-127237058 AAGGATCCCCAAAGTGGAAGTGG + Intronic
1033063611 7:138130803-138130825 TGTAATCCCCAATGTTAAAAGGG - Intergenic
1033723307 7:144084894-144084916 TATACTCCACAATGTGGGAGCGG + Intergenic
1034206685 7:149322207-149322229 TGTAATCCCCAGTGTTGGAGAGG - Intergenic
1037452725 8:19032989-19033011 TATAATCCCTACTTGGGAAGCGG + Intronic
1038106423 8:24440147-24440169 TATAATCCCCACTTTGCAGGTGG - Intergenic
1041103947 8:54423756-54423778 AATAATTCCTGATGTGGAAGAGG - Intergenic
1041479414 8:58301925-58301947 TGTAATACCAAATGTTGAAGAGG + Intergenic
1043864198 8:85357259-85357281 TTTTATCCCCAATGTGGAGCGGG + Intronic
1043941876 8:86205236-86205258 TGTGATTCCCAATGTGGAGGTGG + Intergenic
1044607436 8:94059357-94059379 TCTAAACCCCAAAGTGGACGGGG - Intergenic
1045195150 8:99923153-99923175 AATAATCCCTTATGTAGAAGAGG + Intergenic
1045927094 8:107586756-107586778 TATTATTCCCAATGTCGTAGGGG - Intergenic
1046705285 8:117442553-117442575 GAGAATCCCCAAGGTGGAACAGG - Intergenic
1046998251 8:120547974-120547996 TGTAATCCCCAGTATGGAGGTGG + Intronic
1047329354 8:123872243-123872265 TGTAATTCCCAATGTTGAGGTGG - Intronic
1049060526 8:140272876-140272898 TATCATCCCCAGTGTTGGAGGGG - Intronic
1051232014 9:14964407-14964429 TATTATTCCCAATATGGCAGGGG - Intergenic
1051374360 9:16388792-16388814 TATCATCCCCGATATGGAGGCGG + Intergenic
1051841620 9:21404155-21404177 TATAACCCCAAATGTGGCTGTGG + Intergenic
1053664115 9:40305636-40305658 CGTAATCCCTAATGTTGAAGCGG + Intronic
1053665082 9:40311841-40311863 CGTAATCCCTAATGTTGAAGCGG + Intronic
1053914662 9:42936891-42936913 TGTAATCCCTAATGTTGAAGCGG + Intergenic
1054376243 9:64451871-64451893 CGTAATCCCTAATGTTGAAGCGG + Intergenic
1054519534 9:66064443-66064465 CGTAATCCCTAATGTTGAAGCGG - Intergenic
1054520500 9:66070649-66070671 CGTAATCCCTAATGTTGAAGCGG - Intergenic
1054797897 9:69319505-69319527 TAGAAACCCCTATCTGGAAGAGG + Intergenic
1055400489 9:75918784-75918806 TATAATTCCAAATGTTGATGTGG + Intronic
1055498785 9:76882766-76882788 TGTAATCCCCATTGTTGGAGGGG - Intronic
1055904337 9:81275360-81275382 TATAATCCCCAATGTTGGAGGGG - Intergenic
1056730413 9:89161145-89161167 TATAATCCCCATGTTGGAGGTGG + Intronic
1057940241 9:99275689-99275711 TATAATGCAGAATCTGGAAGTGG - Intergenic
1058519371 9:105803495-105803517 TATAATTCCCAATATTGCAGGGG - Intergenic
1059160015 9:112025229-112025251 TATAATCCCCAATGTTGGGGTGG + Intergenic
1059944432 9:119394486-119394508 CAAAATCCCCAATGTGGCTGAGG + Intergenic
1059959708 9:119553078-119553100 TGTAATTCCCAATGTTGGAGGGG - Intergenic
1060883141 9:127132728-127132750 TATAATCCCCAATTTAGAAAAGG - Intronic
1062304531 9:135896797-135896819 CCTAATCCCCAATGTGGCAGTGG + Intronic
1185668916 X:1790206-1790228 TAAAATGCTCTATGTGGAAGAGG - Intergenic
1185852187 X:3499574-3499596 TGTAATCCCCAATGTTGGGGAGG + Intergenic
1186025145 X:5302139-5302161 TATTATTCACAATGTGGAAGTGG - Intergenic
1186790155 X:12989469-12989491 TATAATACCAACTGTGTAAGAGG - Intergenic
1188263243 X:28041478-28041500 TGTATTCCCCAATTTGGAGGTGG - Intergenic
1188590365 X:31826221-31826243 TATAATCTCTAATGTAGAGGTGG + Intronic
1190575988 X:51839076-51839098 AATAATCTCCAAAGTGGAAGAGG - Intronic
1191118898 X:56882033-56882055 TGTAATCCCCAATGTTAAAGGGG + Intergenic
1191648537 X:63509992-63510014 TATTCTCCCCCATCTGGAAGAGG - Intergenic
1192079588 X:68033704-68033726 TGTGATCCCCAGTGTTGAAGTGG + Intergenic
1193071748 X:77313712-77313734 TATAATAGACAATGAGGAAGTGG + Intergenic
1194047936 X:89032936-89032958 GGTAATCCCCAATGTTGGAGGGG - Intergenic
1194164990 X:90505304-90505326 TGTAATCACCACTGAGGAAGAGG + Intergenic
1194397323 X:93402268-93402290 TGTAATCCCCAGTGTTGAAGAGG + Intergenic
1194428011 X:93763604-93763626 TTTTATCCCCAATTTGGCAGTGG - Intergenic
1194468921 X:94268435-94268457 TATAATCCCCAGTGTTGGAGTGG + Intergenic
1194501010 X:94680812-94680834 TGTAATCCCCCATGTGGAGGTGG + Intergenic
1194543953 X:95208511-95208533 TATCATGCCCAAAGTGGATGGGG - Intergenic
1197739740 X:129880792-129880814 TATACTCCACAGTGTGGGAGCGG + Intergenic
1197794862 X:130287727-130287749 TATACTCCACAGTGTGGGAGTGG - Intergenic
1198313517 X:135444008-135444030 TATGATTCCCAATTTGGAGGTGG - Intergenic
1201264666 Y:12194189-12194211 TCCAATCCCCAGTGTGGAAGGGG + Intergenic
1201645520 Y:16225754-16225776 TATTATTCACAAAGTGGAAGTGG + Intergenic
1201657293 Y:16359560-16359582 TATTATTCACAAAGTGGAAGTGG - Intergenic
1202592442 Y:26500719-26500741 TTTGATCCCCAATGTTGGAGGGG + Intergenic