ID: 1023337653

View in Genome Browser
Species Human (GRCh38)
Location 7:39186935-39186957
Sequence CAGAACACAGAGCAGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023337653_1023337661 19 Left 1023337653 7:39186935-39186957 CCTGCCGCCTGCTCTGTGTTCTG 0: 1
1: 0
2: 1
3: 24
4: 338
Right 1023337661 7:39186977-39186999 GCCTACTAATGTGATCGCCAAGG 0: 1
1: 0
2: 0
3: 1
4: 28
1023337653_1023337663 22 Left 1023337653 7:39186935-39186957 CCTGCCGCCTGCTCTGTGTTCTG 0: 1
1: 0
2: 1
3: 24
4: 338
Right 1023337663 7:39186980-39187002 TACTAATGTGATCGCCAAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 39
1023337653_1023337658 -10 Left 1023337653 7:39186935-39186957 CCTGCCGCCTGCTCTGTGTTCTG 0: 1
1: 0
2: 1
3: 24
4: 338
Right 1023337658 7:39186948-39186970 CTGTGTTCTGGAGCCCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023337653 Original CRISPR CAGAACACAGAGCAGGCGGC AGG (reversed) Intronic
900652272 1:3735465-3735487 CAGAACACGGAGCAGCCAGATGG + Exonic
900695134 1:4004998-4005020 CTGAACACACAGCAGCCTGCGGG + Intergenic
902100442 1:13983440-13983462 CTGCACTCAGAGCAGCCGGCCGG - Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
903581473 1:24374046-24374068 CAGAACACACAGCTAGCTGCAGG + Intronic
906155992 1:43614269-43614291 CAGAGCACAGGGCAGCAGGCAGG - Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906958627 1:50399162-50399184 CAGAACACGAAACAGGCTGCAGG + Intergenic
907428041 1:54393461-54393483 CAGAACTCAGACCAGGCCGGAGG + Intronic
907592574 1:55689879-55689901 CAGAAGCCAGAGCAGGCACCAGG - Intergenic
908571885 1:65419965-65419987 CAGAACGCAGTGCACGCAGCGGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
914845009 1:151278334-151278356 AAAAAAACAAAGCAGGCGGCTGG - Intergenic
915289817 1:154875984-154876006 CAGGACACAGAGCAAGAGGTGGG - Intergenic
916219850 1:162433236-162433258 CCGAACTCGGAGCAGCCGGCCGG + Intergenic
916827119 1:168453082-168453104 CAGAAAGCAGAGCAAGCGGATGG - Intergenic
916870327 1:168907177-168907199 CAGTACACAAAGCAGGTAGCTGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918720819 1:187850284-187850306 CTGCACTCAGAGCAGCCGGCCGG + Intergenic
918853228 1:189718576-189718598 CAGCACTCAGAGCAGCCGGCCGG - Intergenic
919845307 1:201638699-201638721 AAGACCACACAGCAGGCTGCTGG - Intronic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
923113451 1:230912067-230912089 CAGAACACAGAGAAGGGGCGTGG + Intronic
923844417 1:237713011-237713033 CAGATCACAGAGCAGGCCTGAGG - Intronic
924219252 1:241855856-241855878 CCGCACTCAGAGCAGCCGGCCGG - Intronic
924246322 1:242088626-242088648 CAGAGCCCACAGCAGGTGGCCGG - Exonic
1062815089 10:493550-493572 AAGAGCCCACAGCAGGCGGCGGG - Intronic
1062835152 10:630695-630717 CAGGAAACAGACCAGGTGGCAGG + Intronic
1063963786 10:11328858-11328880 CAGAAAACAGAAAAGGGGGCTGG - Intronic
1065377893 10:25061314-25061336 CACCCAACAGAGCAGGCGGCTGG - Intronic
1066649712 10:37642829-37642851 CAGAGCACCGAGCAGGCTCCTGG - Intergenic
1068544062 10:58326964-58326986 CAGGATACGGAGCAGGCAGCAGG - Intergenic
1070189980 10:74103162-74103184 AAGAGCACAGAGGAGTCGGCCGG - Intronic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1075041835 10:119114188-119114210 CAGGAAGCAGAGGAGGCGGCTGG - Intronic
1075840647 10:125499525-125499547 CAGAGCACAGAGCTGCAGGCAGG + Intergenic
1076658747 10:132041430-132041452 CAGAACACAGCCCATGCTGCCGG - Intergenic
1076684095 10:132189154-132189176 GGAAACCCAGAGCAGGCGGCCGG + Intronic
1076768482 10:132650642-132650664 CAGACCACCAAGCAGGCTGCGGG - Intronic
1077039309 11:511644-511666 CAGAAAGCAGACCAGTCGGCAGG + Intergenic
1077518783 11:3018803-3018825 CAGCAGACAGTGCAGGTGGCAGG - Intronic
1079590563 11:22177991-22178013 TGGAACACAGAGCAGTTGGCAGG - Intergenic
1080997610 11:37623067-37623089 CAGAAGGGAGAGCAGGCAGCAGG - Intergenic
1081036130 11:38148790-38148812 CAGAGGACAGAGCTGCCGGCTGG - Intergenic
1081914432 11:46721644-46721666 CAGAACACAGTGCAGGAGGGAGG - Intronic
1083190870 11:61051421-61051443 CAGCACAGAGAGCAGGGGCCTGG + Intergenic
1084093419 11:66894289-66894311 GAGAACAAAGAGGAGGCAGCTGG - Intronic
1084308546 11:68302391-68302413 AGGAACACAGAGCAGGCCCCAGG - Intergenic
1084582523 11:70032805-70032827 CAGAACACATAGGAGGAGGAGGG + Intergenic
1084874942 11:72124277-72124299 CAGTGCCCAGAGCAGCCGGCTGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086123839 11:83329040-83329062 CAGAAGACAGATCAGGATGCTGG + Intergenic
1087486406 11:98763688-98763710 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1088572328 11:111234476-111234498 GAGAACATAGAGCAAGGGGCTGG + Intergenic
1089003107 11:115068528-115068550 CAGAACCCACAGCAGGGGCCAGG + Intergenic
1089244752 11:117110730-117110752 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089466191 11:118688042-118688064 CAGAAGGCTGAGCAGGAGGCTGG + Intergenic
1089663523 11:120001566-120001588 GAGCACACAGGGCAGGTGGCGGG - Intergenic
1091386600 12:99935-99957 CAGAACACAGATCGGGGGGCGGG - Intronic
1091790406 12:3268905-3268927 AGGAACACAGGGCAGGCTGCAGG - Intronic
1091790469 12:3269235-3269257 AGGAACACAGGGCAGGCTGCAGG - Intronic
1091790473 12:3269255-3269277 AGGAACACAGGGCAGGCTGCAGG - Intronic
1092208825 12:6633231-6633253 CAGGACACAGGTCAGGGGGCTGG - Intronic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092833653 12:12468112-12468134 CAGACCACAGGCCAGGCGGTTGG - Exonic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093970198 12:25369449-25369471 CCGCACTCGGAGCAGGCGGCCGG + Intergenic
1094375612 12:29784419-29784441 GAGAGCACAGAGCCGGCGACTGG - Intronic
1094465778 12:30753433-30753455 CAGAACTCAGAGTAGACTGCAGG + Exonic
1094798732 12:34004851-34004873 AAGAACACAGAGTAGCAGGCTGG + Intergenic
1097017941 12:56000421-56000443 CCGCACACGGAGCAGCCGGCTGG - Intronic
1098519697 12:71421254-71421276 CAGAAATCAGAGCAGGCACCAGG + Intronic
1102173344 12:110858803-110858825 CAGAACACAGAGCAAAGGGGAGG + Intronic
1102286872 12:111664797-111664819 CAGAACCCAGAGAAGGCAGTGGG - Intronic
1102420802 12:112801324-112801346 CATCACACAGAGCATGCAGCAGG + Intronic
1102983908 12:117263818-117263840 GAGAACCCAGAGAAGGAGGCTGG - Intronic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1103925062 12:124419030-124419052 CACCACACAGAGGAGGCGGGTGG - Intronic
1104503020 12:129303950-129303972 CAGAACACAAAGGTGGAGGCAGG - Intronic
1104900814 12:132188748-132188770 CAGAACACAGAGCAGTTGCTGGG - Intergenic
1105260744 13:18777476-18777498 CAGAGCACAGAACTGGAGGCTGG - Intergenic
1107826081 13:44330258-44330280 CAGCCCACACAGCAGGCTGCAGG - Intergenic
1107920963 13:45206872-45206894 CAGAAGTCAGAGCAGCTGGCAGG + Intronic
1112433537 13:99373889-99373911 CTGGACACAGAGGAGGGGGCAGG + Intronic
1112979799 13:105369137-105369159 CAAAACATAGGGCAGGCTGCGGG + Intergenic
1113048761 13:106185364-106185386 CAGAATACAGAGCAAGTGACAGG - Intergenic
1113059250 13:106303501-106303523 CAGAAGACTGAGCAGGTGGAGGG + Intergenic
1113321995 13:109243015-109243037 TAGAACACAGAGGAGGAGGAAGG + Intergenic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1114553139 14:23545717-23545739 CAGAACACAGAGATGGCTGGGGG + Intronic
1115274069 14:31587012-31587034 CGGAAAACAGAGGAGGCAGCTGG + Intronic
1116317596 14:43417644-43417666 CAGAATACAGGTCAGGTGGCTGG + Intergenic
1118775308 14:68970195-68970217 CAGGCCAAAGAGCAGTCGGCTGG - Intronic
1118805927 14:69236917-69236939 TACAACACAGAGCAGGCTTCAGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1121243738 14:92448136-92448158 CAGAGGTCAGTGCAGGCGGCTGG + Intronic
1122008628 14:98727284-98727306 TGGAAGACAGAGCAGTCGGCAGG - Intergenic
1122366964 14:101200089-101200111 TAGATCACACAGCAGGTGGCAGG + Intergenic
1122818356 14:104326494-104326516 CAGAAGGCAGGGCAGGGGGCAGG - Intergenic
1122854969 14:104555712-104555734 CAGAACAAAGAGGAGGCTGGAGG + Intronic
1123702847 15:22928503-22928525 CAGAGCACAGAGCAAGGGACAGG + Intronic
1124070443 15:26388037-26388059 CTGAAAACAGAGCAGGAGGTTGG - Intergenic
1125214855 15:37259935-37259957 CAGAAGAAAGAGCAGGCAGGAGG - Intergenic
1126088975 15:45034917-45034939 CCGCACTCAGAGCAGCCGGCCGG + Intronic
1129362585 15:75033679-75033701 CAGGACACAGAGCGGGCAGGTGG - Intronic
1129463337 15:75710763-75710785 CAGAAATCAGGGCAGGCAGCTGG + Intronic
1129570920 15:76682727-76682749 CAGAAAACAAAGCAGAGGGCTGG + Intronic
1129721550 15:77880639-77880661 CAGAAATCAGGGCAGGCAGCTGG - Intergenic
1129777516 15:78246415-78246437 CTGCACTCAGAGCAGCCGGCCGG - Intergenic
1130272748 15:82460806-82460828 CAGAACACAGAGCATCTGCCTGG + Intergenic
1130363065 15:83208080-83208102 AACAAAAGAGAGCAGGCGGCGGG - Intergenic
1130465098 15:84188159-84188181 CAGAACACAGAGCATCTGCCTGG + Intergenic
1130487590 15:84406643-84406665 CAGAACACAGAGCATCTGCCTGG - Intergenic
1130499167 15:84485377-84485399 CAGAACACAGAGCATCTGCCTGG - Intergenic
1130587389 15:85192772-85192794 CAGAACACAGAGCATCTGCCTGG + Intergenic
1131000993 15:88940051-88940073 AAGAAAACAGAGAAGGCGCCAGG + Intergenic
1131717655 15:95130842-95130864 AAGATCACACAGCAAGCGGCAGG - Intergenic
1132062450 15:98703528-98703550 CAAACCACAGAGCACGAGGCAGG - Intronic
1132336588 15:101051982-101052004 CAGAACACAGTGCAGGTCACAGG + Intronic
1132726295 16:1339719-1339741 CAGCACACAGAGACGGCTGCAGG + Intronic
1132896825 16:2233203-2233225 CAGAAGACAGAGCAGCCCTCCGG - Intronic
1132931864 16:2462751-2462773 CAGACCTCAGTGCAGGTGGCAGG - Intronic
1133558319 16:6926433-6926455 CTGAACACCGATCAGGAGGCAGG - Intronic
1135354186 16:21755968-21755990 CAGAACACAGTTCAGGCTCCTGG - Intronic
1135452676 16:22572109-22572131 CAGAACACAGTTCAGGCTCCTGG - Intergenic
1136266356 16:29121715-29121737 CAGGACACAGGGCGGGCGACAGG + Intergenic
1136266369 16:29121767-29121789 CAGGACACAGGGCGGGCGACAGG + Intergenic
1136266393 16:29121869-29121891 CAGGACACAGGGCAGGTGACAGG + Intergenic
1136983721 16:35081709-35081731 CAGGGCACAGAGCAAGAGGCTGG - Intergenic
1139010756 16:62630804-62630826 CAGAACACACAGCAGGTAGTTGG + Intergenic
1141290632 16:82715380-82715402 CAGAAACCAGAGCATGGGGCGGG - Intronic
1141421171 16:83917511-83917533 CAGAAGACAGAGAAGGGGCCTGG - Exonic
1142055242 16:87989930-87989952 CAGGACACAGGGCGGGCGACAGG + Intronic
1142055254 16:87989982-87990004 CAGGACACAGGGCAGGTGACAGG + Intronic
1142600670 17:1052176-1052198 CAGAACACACAGAACGGGGCTGG + Intronic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142894089 17:2963492-2963514 CGGGACCCAGAGCAGGCTGCAGG - Intronic
1143870932 17:9956913-9956935 CAGAACCCAGAGGAAGAGGCTGG + Intronic
1144682042 17:17202722-17202744 CAGAACGCACAGCAGCCCGCAGG + Exonic
1145989013 17:29066943-29066965 CAGAAATCATAGCAGGCGGGTGG - Intergenic
1146740484 17:35279191-35279213 CCAAACTCAGAGCAGCCGGCTGG - Intergenic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1147993524 17:44349437-44349459 CACAACACTGAGCAGGCATCTGG + Exonic
1148666474 17:49378738-49378760 CAGAACACTGAGCACAGGGCTGG - Intronic
1150786765 17:68169635-68169657 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1150934935 17:69625046-69625068 AAAAACACAGAGCAGGATGCTGG + Intergenic
1151527059 17:74677730-74677752 CAGATCCCAGAGCAGGCAGCTGG + Intronic
1151817958 17:76480790-76480812 CAGAAGACACAGCAGCAGGCAGG - Intronic
1152234855 17:79133218-79133240 GAGAAGACAGAGGAGGCTGCAGG + Intronic
1152919118 17:83057019-83057041 CAGAACGCAGAGCCGGAGTCAGG + Intergenic
1153660723 18:7323551-7323573 CAGAACACAGAGCTGGGGAGGGG - Intergenic
1154028326 18:10727170-10727192 CTCAACACAGAGCTGGAGGCAGG - Intronic
1154033245 18:10772507-10772529 CAGAACACAGAGGAGAGGACTGG - Intronic
1154231450 18:12559365-12559387 CAGCACTCAGAGCTGCCGGCTGG - Intronic
1158189768 18:54813568-54813590 CAGAAGGCAGAGCAGGAGCCAGG - Intronic
1160366163 18:78327748-78327770 CAGAACTCAGAGCAGCCTGCAGG + Intergenic
1160847233 19:1171998-1172020 CAGAGCACAGAAGAGGCAGCAGG - Intronic
1160991379 19:1861697-1861719 CAGAACAGAGAGGGGGCGGCCGG + Intronic
1164908301 19:31985426-31985448 CACAACACAGAGCAGATCGCTGG + Intergenic
1165826378 19:38708285-38708307 CAGAACCCAGATCTGGAGGCTGG - Intronic
1166069343 19:40378157-40378179 CGGGCCTCAGAGCAGGCGGCAGG - Exonic
1166329568 19:42070175-42070197 CAGGACCCAGCGCAGGCGGCAGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167227366 19:48255711-48255733 CAGAACACAGAGCAGCCTGGCGG + Intronic
1168686961 19:58354652-58354674 CAGGACAGAGAGCATGCAGCAGG - Exonic
925207128 2:2016279-2016301 CAGAACACAGAGCAAGAAGATGG + Intronic
925284963 2:2709778-2709800 CTTAGCACAGAGCAGGCAGCTGG + Intergenic
925843675 2:8016795-8016817 AAGAACACAGAGCTGGAGGTAGG - Intergenic
927230751 2:20822471-20822493 CAGGACACAAAGCAGGTGTCCGG + Intronic
927703676 2:25283964-25283986 CAGAGCACACAGCAGGCACCCGG - Intronic
927777791 2:25915584-25915606 CTGCACTCAGAGCAGCCGGCCGG + Intergenic
928712685 2:34024874-34024896 AAGAACACAGAGCTGGCCTCAGG - Intergenic
932024172 2:68116752-68116774 CAGTCCACAGGGCAGGCAGCTGG - Intergenic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
934553755 2:95276946-95276968 CAGAGCACAGGGCAGTCTGCAGG - Intronic
936267819 2:111023708-111023730 CAGAACACAGGGCTGGAGGAAGG + Intronic
937067074 2:119025630-119025652 TTGAACACAGAGCAGTCTGCAGG - Intergenic
937202127 2:120210422-120210444 CTGAAAACAGAGAAGGTGGCTGG + Intergenic
937688494 2:124725040-124725062 AAGAACACAGAGCAGTTTGCCGG - Intronic
938067002 2:128286802-128286824 CAGAAAACAGAGCAGGCTGCTGG + Intronic
938097654 2:128474090-128474112 CAGGCCACAGAGCAGGCTGAGGG - Intergenic
938384522 2:130854763-130854785 CAGAACACAGAGCTGGGGGTGGG - Intronic
938961178 2:136343068-136343090 AAGAACTCAGAGCACGCAGCAGG - Intergenic
941026547 2:160462299-160462321 CATAAGACAGAGCAGAGGGCAGG - Intronic
941240067 2:163026358-163026380 CCGCACTCAGAGCAGACGGCCGG + Intergenic
944125747 2:196290791-196290813 CAGAACACTGAGCTGGAAGCAGG - Intronic
945233833 2:207616251-207616273 CAGTACACAGAGCACTCTGCAGG + Intronic
945314993 2:208361097-208361119 CAGCACACACAGCAGGCAGTGGG + Intronic
947618832 2:231575867-231575889 CAGCACCCAGAGCAGGAGGGAGG + Intergenic
947720404 2:232366423-232366445 CCGCACTCTGAGCAGGCGGCCGG + Intergenic
948594084 2:239068300-239068322 GAGAGCCCAGAGCAGGCAGCGGG - Intronic
948599877 2:239101909-239101931 CAGAACACAGACCCGGGGCCGGG - Intronic
948692317 2:239714335-239714357 CAGAATGCAGAGCAGGGGGGTGG + Intergenic
948877462 2:240837271-240837293 CTACACACAGAGCAGGAGGCTGG + Intergenic
1168818967 20:760947-760969 CAGGTCACAGAGCAAGGGGCAGG - Exonic
1168998651 20:2150828-2150850 CAGAGCACTGAGTAGGTGGCTGG - Intronic
1171271795 20:23823882-23823904 GAGAAGACAGAGAAGGCTGCAGG - Exonic
1171460839 20:25297067-25297089 CAGGACAGAGGGCAGGGGGCAGG - Exonic
1172861362 20:38055592-38055614 CAGAAGAAAGAGCACGCTGCAGG - Intronic
1173616563 20:44407029-44407051 CAGAACCCATAGCAGGCTCCTGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1175823880 20:61926144-61926166 GAGAAAACAAAACAGGCGGCTGG + Intronic
1175891286 20:62317156-62317178 CAGTACACCCAGCAGGCGACAGG - Intronic
1176197962 20:63846337-63846359 GGGAACGCAGAGGAGGCGGCAGG + Intergenic
1177792523 21:25735663-25735685 CAAAACACAGAGGCGGCCGCGGG - Intronic
1179088605 21:38242752-38242774 GGGAACACAGAGCAGGTGGCAGG - Intronic
1179217274 21:39378382-39378404 CAAAACAAAGAGCAGGAGTCTGG - Intergenic
1179474978 21:41637280-41637302 GAGGGCACAGAGCAGGGGGCTGG - Intergenic
1180192364 21:46172012-46172034 AAGAACACACAGCACGAGGCAGG + Intronic
1180698229 22:17767716-17767738 CAGAACACAGAGTCAGGGGCAGG + Intronic
1181414040 22:22746562-22746584 CAGGACACTGAGCAGGGGCCTGG + Intronic
1181580902 22:23827559-23827581 CATAAGAGAGAGCAGGGGGCAGG - Intronic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1183602073 22:38845509-38845531 CAAAACCCAGGGCAGGCAGCTGG + Intergenic
1184844604 22:47073663-47073685 CAGACCCCAGGGCAGGCAGCAGG + Intronic
1185045251 22:48525443-48525465 CAGAAGGCGGAGCAGGTGGCAGG - Intronic
1185137966 22:49084116-49084138 CAGCTCAGAGAGCAGGCAGCTGG + Intergenic
949584534 3:5424965-5424987 CAAAACAAAGAGGAGGCAGCTGG - Intergenic
949769974 3:7568679-7568701 CAGCACTCAGAGCAGCGGGCCGG + Intronic
949879932 3:8653198-8653220 CAGACCTCAGAGCAAGAGGCAGG + Intronic
950108713 3:10404900-10404922 CAGAGCACATAGCAAGGGGCAGG - Intronic
950406816 3:12810088-12810110 CAGCAGACAGTGCAGGAGGCTGG - Exonic
951862939 3:27274086-27274108 CTAAACAAAGAGTAGGCGGCAGG + Intronic
954110005 3:48428684-48428706 CAGAAAACAGGGCGGGCAGCGGG - Intronic
954456252 3:50601287-50601309 AAGAACTCAGAGGAGGCCGCAGG - Intergenic
956763393 3:72463298-72463320 CAGAATGCAGTGCAGGGGGCTGG + Intergenic
957804925 3:85134138-85134160 CCGCACTCAGAGCAGCCGGCCGG - Intronic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961441288 3:126954801-126954823 CAGAAGACACAGCAAGAGGCTGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
964292970 3:155202245-155202267 AAGAATACAGAGCAGGGGCCAGG + Intergenic
964406360 3:156352826-156352848 CAGGAAACAGGGCAGGCAGCAGG - Intronic
965092233 3:164179331-164179353 CTGCACTCAGAGCAGCCGGCCGG + Intergenic
965245258 3:166258745-166258767 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
966191034 3:177272005-177272027 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
966926266 3:184646541-184646563 CAAAACACAGACCAGGCCGGGGG - Intronic
966933563 3:184691309-184691331 CTGAGCATAGGGCAGGCGGCAGG - Intergenic
968066054 3:195760422-195760444 AAGAACACAGAGGAGCCTGCGGG + Intronic
968621465 4:1605178-1605200 CAGAATTCAGAGTAGGCGGTGGG + Intergenic
968984308 4:3866848-3866870 CAGAACACAGAATGGGCTGCGGG + Intergenic
969426931 4:7129954-7129976 CAGAAGGCAGAGCAGGCTGGGGG + Intergenic
969444331 4:7235520-7235542 GAGAACACAGAGCGGGTGGATGG + Intronic
969657149 4:8504925-8504947 CAGGACCCAGACCAGGAGGCTGG - Intergenic
970589361 4:17546029-17546051 CAGAACCCAGCGCAGGCAGACGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
973559919 4:52124923-52124945 CAGAGCACAGAGCAGGGAGAAGG - Intergenic
974033788 4:56799573-56799595 GAGAACACTGACCAGGCTGCTGG - Intergenic
974484805 4:62492173-62492195 CCGCACTCAGAGCAGCCGGCGGG - Intergenic
976246698 4:83012494-83012516 CAGACCGCCGGGCAGGCGGCTGG + Intronic
977299836 4:95255274-95255296 AAGAACACAGAGCGGGGTGCCGG - Intronic
977810137 4:101347761-101347783 AAGAAAACAGAGCAAGGGGCGGG - Exonic
979005656 4:115292619-115292641 CAGAACACAGAGCAGGGGAAGGG - Intergenic
979718170 4:123866683-123866705 CAGAAGGCACAGCAGGGGGCCGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
982105417 4:152007879-152007901 CAGAACACAGGAAAGGCGGCAGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
984885391 4:184445118-184445140 CAGAACTCAGAGCATGCGCCGGG + Intronic
985023204 4:185713106-185713128 CAGGACACAGAGGATGCTGCCGG - Intronic
985590872 5:764445-764467 CTGCACTCAGAGCAGCCGGCCGG + Intronic
985781126 5:1872360-1872382 CAGAGCCCAGAGCAGGGGCCAGG - Intergenic
985877684 5:2612804-2612826 CAGAACACAGAGGAGCTGGCTGG + Intergenic
986020310 5:3795530-3795552 CAGAACTCAGAGCTGACTGCAGG + Intergenic
987528818 5:19088422-19088444 TAGAACACAGAGGAGGAGGAGGG - Intergenic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
988526151 5:31988902-31988924 CTAATGACAGAGCAGGCGGCAGG - Intronic
990557378 5:56950943-56950965 CAAAACCCAGAGCAGTCGGCTGG + Intronic
991657780 5:68920952-68920974 CCGCACTCAGAGCAGCCGGCCGG + Intergenic
996184925 5:120464047-120464069 CAGAACCAAGAGGAGGGGGCGGG + Intergenic
997846029 5:137286683-137286705 CAAATCACAGAGCAGGAGGGTGG + Intronic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1000626460 5:163545012-163545034 TAGATTAAAGAGCAGGCGGCCGG - Intergenic
1001973806 5:175979738-175979760 CAGCACCCAGAGCAGCCAGCCGG + Intronic
1002050581 5:176568462-176568484 CTGGACACAGTGCAGGGGGCGGG - Intronic
1002243626 5:177864041-177864063 CAGCACCCAGAGCAGCCAGCCGG - Intergenic
1002664337 5:180811207-180811229 CAGAACACAGGCCAGGAGACCGG - Intronic
1003220305 6:4155241-4155263 CAGAAAACAGAGGAAGGGGCTGG + Intergenic
1004013380 6:11710671-11710693 CAGAACTGAGAGAAGGCAGCCGG + Intergenic
1004233721 6:13854992-13855014 CAGCACTCGGAGCAGCCGGCCGG - Intergenic
1006743750 6:36326869-36326891 CAGAGCCCAGAGCAGGGGGAGGG + Intronic
1007417930 6:41702929-41702951 CAGCACACCAGGCAGGCGGCAGG - Intronic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1008254056 6:49275526-49275548 CTGCACTCAGAGCAGCCGGCTGG + Intergenic
1008640909 6:53461904-53461926 CAGTTCGGAGAGCAGGCGGCAGG - Intergenic
1008816134 6:55569001-55569023 AAGAACACAGAGTAGGGGGAGGG + Intronic
1008965217 6:57307894-57307916 AAGAACACAGAGCAGGGGAGGGG + Intergenic
1011557826 6:88588023-88588045 CAGAACACAGTGCTGCCTGCTGG + Intergenic
1012150764 6:95748422-95748444 CAGAAAACAGAGCAGGAGTAAGG - Intergenic
1012512751 6:100023085-100023107 CAGAACACACATCATGTGGCAGG + Intergenic
1012935644 6:105364591-105364613 CAGGACACAGGGCAGGATGCGGG - Intronic
1013551679 6:111213794-111213816 CAGGCCACACAGCAGGTGGCTGG - Intronic
1013601864 6:111712557-111712579 CAGAGCACAGAGCTGGCAGGTGG - Intronic
1013792969 6:113857262-113857284 CCGCACACAAAGCAGGGGGCGGG - Intergenic
1014921088 6:127214866-127214888 CTGCACTCAGAGCAGCCGGCCGG - Intergenic
1016041832 6:139439662-139439684 CAGAAGATAGTGCAGGCTGCTGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017717675 6:157223711-157223733 GGGAACACAGAGAAGGTGGCTGG + Intergenic
1018064255 6:160114777-160114799 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1019014953 6:168873474-168873496 CAGAACCCCGAGCTGGCGGCCGG + Intergenic
1019316568 7:389702-389724 CAGAACTCAGGGCAGAGGGCGGG - Intergenic
1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG + Intergenic
1021573877 7:22090495-22090517 CCGAACTCAGAGCAGCCAGCCGG + Intergenic
1023063740 7:36354200-36354222 CAGGACATACAGCAGGCTGCAGG - Intronic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1024596454 7:50941535-50941557 AAGAACACAGCGCAGGGGGATGG + Intergenic
1024834029 7:53495105-53495127 CCGCACTCAGAGCAGCCGGCCGG + Intergenic
1026178306 7:68016907-68016929 CAGCACACAGCCCAGGAGGCCGG - Intergenic
1026335881 7:69393911-69393933 CCGCACTCAGAGCAGCCGGCCGG + Intergenic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1030480221 7:110093985-110094007 CAGAAAACAATGCAGGTGGCAGG + Intergenic
1032023153 7:128421323-128421345 TAGAACAGAGGGCAGGGGGCAGG + Intergenic
1032166735 7:129551195-129551217 CAGCGCACAGAGCAGGTTGCTGG + Intergenic
1032455974 7:132073847-132073869 CAGCACAGAGAGCAGGCCCCGGG - Intergenic
1032578439 7:133081246-133081268 CAGGTCACAGAGGAGGCGCCTGG + Intronic
1034552462 7:151830306-151830328 CACAGCACAGTGCAGGTGGCGGG - Intronic
1035752163 8:2003308-2003330 CAGGACACAGAGAAGGCTGTGGG + Exonic
1035777088 8:2196412-2196434 CGGAACACTGACCAGGAGGCTGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036640302 8:10579459-10579481 GAGAACTGAGAGCAGGAGGCAGG + Intergenic
1036642176 8:10591548-10591570 CAGGACAATGAGCCGGCGGCAGG + Intergenic
1036917840 8:12821698-12821720 CAGAAGACAAGGCAAGCGGCAGG - Intergenic
1037323339 8:17664563-17664585 CAGAACTGAGAGGAGGAGGCCGG - Intronic
1039797034 8:40924521-40924543 CAGAACAGAGGGCAGGTGGCTGG + Intergenic
1040582263 8:48707642-48707664 CAGAGCACAGGGCAGGGTGCAGG + Intergenic
1042747559 8:72123415-72123437 AAGAACACAGGGCAGGAAGCTGG + Intergenic
1042848038 8:73187778-73187800 CAGATGTCAGAGCAGGTGGCAGG + Intergenic
1043383010 8:79723045-79723067 CAGAACACACTGCACGGGGCAGG + Intergenic
1046018390 8:108634123-108634145 CAGAACACAAAGCAGTCACCTGG + Intronic
1046288886 8:112132775-112132797 CCGCACTCAGAGCAGCCGGCAGG + Intergenic
1047363594 8:124192251-124192273 TAGAAAACAGAGCAGCCAGCAGG - Intergenic
1047523280 8:125612090-125612112 CAGAACTCAGAGCTTGCTGCAGG + Intergenic
1048359795 8:133688087-133688109 CAGAACACAGGGTAGGCTGGGGG + Intergenic
1048496506 8:134940270-134940292 AGGAACACAGGGCAGGGGGCAGG + Intergenic
1049093416 8:140534041-140534063 CTAGACACAGAGCAGGTGGCAGG - Intronic
1049805759 8:144538082-144538104 GAGAACACAGGGAAGGCGCCTGG + Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1053475695 9:38380708-38380730 CAAAGCACAGAACAGGCGCCTGG + Intergenic
1055461874 9:76527386-76527408 CAGAACACAGAACATGCCTCAGG + Intergenic
1056559644 9:87718973-87718995 CAGGTCACAGAGCAGGTGGAGGG - Intergenic
1056677022 9:88684365-88684387 CAGATCACTGAGCTGGCTGCGGG + Intergenic
1057194911 9:93111504-93111526 CAGAACACAGTGCAGACGGTGGG + Intronic
1057489900 9:95512387-95512409 CAGACCACAGGGGAAGCGGCGGG - Intronic
1057866751 9:98687568-98687590 CAGATCCCAGAGCAGGCCTCTGG - Intronic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058472960 9:105299825-105299847 CAGCAGACACAGCAGGCAGCAGG - Intronic
1059497502 9:114721571-114721593 CAGCACACAGAGCAGGGAGAAGG - Intergenic
1060016201 9:120088423-120088445 CAGGACACAGAGCAGTAGGGAGG + Intergenic
1060521309 9:124295559-124295581 CAGGTCACACAGCAGGCGGCAGG - Intronic
1060816417 9:126637831-126637853 CAGTACAGAGAGCGGGGGGCGGG - Intronic
1060978904 9:127781316-127781338 CAGAAGTGAGAGCAGGGGGCTGG - Intergenic
1061823148 9:133239653-133239675 AGGCACACAGAGCAAGCGGCGGG + Intergenic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062390865 9:136333367-136333389 CAGGCCCCAGAGCAGGCAGCAGG + Intronic
1187512657 X:19935997-19936019 AAGAACACAAAGCAGGGAGCAGG + Intronic
1188265150 X:28064581-28064603 CAAAACACAAAACAGGCAGCGGG - Intergenic
1190291388 X:48995055-48995077 CAGAACATAGAGCATGTGGTGGG + Intronic
1192236474 X:69299447-69299469 AAGAGCACAGAGTAGGCGACTGG - Intergenic
1198152124 X:133921819-133921841 CACATCACAGAGCAGGCAACTGG - Intronic
1198752215 X:139947189-139947211 CAGAATGCAGAGAAGGCGACAGG - Intergenic
1200006901 X:153091989-153092011 TTGAACAAAGAGCAGGGGGCAGG - Intergenic
1201488141 Y:14512897-14512919 CTGCACTCAGAGCAGCCGGCTGG + Intergenic
1202370136 Y:24190546-24190568 CAGAACACAGAGCATCTGCCTGG - Intergenic
1202500648 Y:25479571-25479593 CAGAACACAGAGCATCTGCCTGG + Intergenic