ID: 1023344043

View in Genome Browser
Species Human (GRCh38)
Location 7:39252921-39252943
Sequence CAGAAAATGGACAAATACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 396}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023344043_1023344053 18 Left 1023344043 7:39252921-39252943 CCTGAGTATTTGTCCATTTTCTG 0: 1
1: 0
2: 2
3: 31
4: 396
Right 1023344053 7:39252962-39252984 AAAGAATGTAAGCTCCAGCAGGG No data
1023344043_1023344052 17 Left 1023344043 7:39252921-39252943 CCTGAGTATTTGTCCATTTTCTG 0: 1
1: 0
2: 2
3: 31
4: 396
Right 1023344052 7:39252961-39252983 CAAAGAATGTAAGCTCCAGCAGG 0: 1
1: 0
2: 0
3: 34
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023344043 Original CRISPR CAGAAAATGGACAAATACTC AGG (reversed) Intronic
900760216 1:4465367-4465389 GTGAAAATGGACTAATACACAGG + Intergenic
901337108 1:8459881-8459903 CATAAAATGGTCAACAACTCTGG + Intronic
902415196 1:16234451-16234473 CATAAAATGGACTAAGACGCGGG + Intronic
902925306 1:19692087-19692109 GTGAAAATGGACTAATACACTGG + Intronic
903626685 1:24735732-24735754 CAGACAATAAACAAATACCCGGG - Intergenic
904352671 1:29919038-29919060 GTGAAAATGGACTAATACACAGG - Intergenic
907719097 1:56954707-56954729 CATGAAATGGACCAATACTGGGG - Exonic
908528536 1:65011312-65011334 CAAAAAATGGAAAAATAAGCTGG + Intergenic
908814359 1:68016340-68016362 CAGAAAAGGGATAAAAATTCAGG + Intergenic
909592046 1:77361569-77361591 ATGAAAATGGACTAATACACAGG - Intronic
910018788 1:82559485-82559507 CAGAAAATAGAAAAAGGCTCTGG + Intergenic
910166716 1:84336293-84336315 GTGAAAATGGACCAATACACTGG - Intronic
910512730 1:88024774-88024796 ATGAAAATGGACTAATACACTGG - Intergenic
912987697 1:114451199-114451221 CAAAAAATGGACCTATTCTCTGG - Intronic
913182784 1:116338389-116338411 AAAAAAATGAACAAATCCTCAGG + Intergenic
915125032 1:153657972-153657994 CAGAAAATGAAAAATTAGTCAGG + Intergenic
916036167 1:160924319-160924341 ACGAAAATGGACAAATACAAGGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917785533 1:178452511-178452533 CAGAAAACGGAGAAATAATGAGG - Exonic
917891827 1:179447029-179447051 CATAGAAGGGATAAATACTCAGG - Intronic
920030927 1:203036922-203036944 TAGAAACTGGACACAAACTCTGG - Intronic
920392763 1:205620391-205620413 CTGAAGATGGAGAAATACTTGGG + Exonic
921042715 1:211448925-211448947 CAGAACAAAGAGAAATACTCTGG + Intergenic
921282650 1:213582646-213582668 CAGAAGATTGAAAACTACTCTGG + Intergenic
922152455 1:223017615-223017637 ATGAAAATGGACTAATACACAGG - Intergenic
922315985 1:224442430-224442452 CAGATTATTGACAAATACTGTGG + Intronic
922737506 1:227995517-227995539 CAGCAAATGGACCAAGATTCAGG - Intergenic
922963522 1:229668023-229668045 ATGAAAATGGACTAATACACGGG - Intergenic
922992545 1:229926994-229927016 CAGAGAAATGATAAATACTCAGG - Intergenic
923264634 1:232302462-232302484 CAGAGAATGGAGAAATAACCAGG - Intergenic
923465717 1:234246488-234246510 CAGAGAGTGGAAAACTACTCTGG + Intronic
923581666 1:235222240-235222262 TGGAAAATGGAAAAATATTCAGG + Intronic
1063929202 10:11012400-11012422 CAGAAAAAGGACAGACATTCAGG + Intronic
1064947180 10:20804207-20804229 GAGAAAAGGGACAGATAGTCAGG + Intronic
1067492744 10:46727445-46727467 CAGAAAATGGACTAAGACAATGG - Intergenic
1067601922 10:47612950-47612972 CAGAAAATGGACTAAGACAATGG + Intergenic
1068191952 10:53664243-53664265 AATTAAATGGACAATTACTCTGG - Intergenic
1068313865 10:55316117-55316139 CAGAAAATGGAAAAATTTTTGGG - Intronic
1069107533 10:64401866-64401888 AAGAAAAAGGAGAAAAACTCTGG - Intergenic
1072292420 10:93976406-93976428 CAGAGAATAAGCAAATACTCAGG + Intergenic
1072646731 10:97261747-97261769 AAGAAACAGGAAAAATACTCAGG + Intronic
1072808378 10:98440147-98440169 AAGAAAATGGACTAATACAGGGG + Intronic
1072845008 10:98819691-98819713 CAGACATTGGACAAATCCACTGG + Intronic
1072919417 10:99563426-99563448 ATGAAAATGGACTAATACACTGG - Intergenic
1073554065 10:104430786-104430808 AAGAAAATGTAAAAATAATCAGG + Intronic
1073872792 10:107884911-107884933 GTGAAAATGGACTAATACACTGG + Intergenic
1074171336 10:110941286-110941308 CAGAAAATGGGCAAAGACTCAGG - Intronic
1075089215 10:119433857-119433879 GTGAAAATGGACTAATACACTGG - Intronic
1075490484 10:122863765-122863787 CTGAAAATGGAAAAACAGTCAGG - Intronic
1076110918 10:127858674-127858696 CAAAAAATAGAAAAATTCTCTGG + Intergenic
1076178564 10:128387521-128387543 GAGAAAATGTACCAACACTCAGG - Intergenic
1076491634 10:130865822-130865844 TACAAAATGGGCAAAGACTCTGG - Intergenic
1076498621 10:130916582-130916604 CAGAAAAAGGACAAAGGCTAGGG - Intergenic
1076709431 10:132323720-132323742 CAGAAAATGGACCAAGACACTGG - Intronic
1077363442 11:2151419-2151441 CGCAAAATGGACAAAAACTGGGG + Intronic
1077387703 11:2278942-2278964 CAGAAAGTGACCATATACTCAGG + Intergenic
1078033941 11:7782929-7782951 CAGAAAATCAACAGATATTCAGG + Intergenic
1078530836 11:12135786-12135808 CAGACTGTGGACAAAGACTCAGG - Intronic
1078709043 11:13772601-13772623 AAGAAAATGAACAAATAAGCAGG - Intergenic
1078938290 11:15972108-15972130 CAGAAAATGGTAAGGTACTCAGG - Exonic
1079670648 11:23165983-23166005 GTGAAAATGGACAAATACAGTGG + Intergenic
1079678108 11:23258390-23258412 CAGAATATGGACACATACTCAGG + Intergenic
1080021447 11:27564471-27564493 AAGATAATGGAAAAATACTTTGG - Intergenic
1081785299 11:45742350-45742372 CAGAAAAAGGAAAAATACCAGGG + Intergenic
1082308978 11:50621759-50621781 CACAAAATGGACAAAAACAGTGG + Intergenic
1085609002 11:77929615-77929637 CAGGAATAGGACCAATACTCAGG + Intronic
1085651694 11:78274063-78274085 ATGAAAATGGACTAATACACTGG + Intronic
1086047385 11:82548839-82548861 GTGAAAATGGACTAATACACAGG - Intergenic
1086434542 11:86768448-86768470 CAGAAAATGGACTAAGACACTGG + Intergenic
1086606392 11:88701301-88701323 CAGAAAATTGACAAGTACAGTGG + Intronic
1086721521 11:90127535-90127557 AAGAAAATGGACTAATACAAAGG - Intergenic
1086762384 11:90648704-90648726 CAGAAAATTAACAGACACTCAGG - Intergenic
1087507747 11:99048430-99048452 CTGAAAATAGAGAAATACTGGGG - Intronic
1087688913 11:101297356-101297378 AAGGCAAAGGACAAATACTCAGG - Intergenic
1088741007 11:112766724-112766746 AAGAAAATGGACTAATACATAGG + Intergenic
1089567499 11:119379545-119379567 CAGAAAGGGGACTAGTACTCAGG + Intronic
1090058176 11:123441123-123441145 CTGAAAATGGACTAATACAGGGG + Intergenic
1090717921 11:129446678-129446700 CTGAGAAAGGACAAATGCTCAGG - Intronic
1090940536 11:131384297-131384319 CAAAAAGTGGACAAATACATAGG + Intronic
1091132463 11:133157999-133158021 CAGAAAATTGAAAAATAATAGGG + Intronic
1091758436 12:3071562-3071584 AAGAAAACTGACAAATACACAGG - Intergenic
1092168745 12:6360090-6360112 CACAAAATGGACTAACACACAGG + Intronic
1093315757 12:17647669-17647691 GTGAAAATGGACTAATACACTGG + Intergenic
1095292630 12:40492954-40492976 TAGAAAATGTCCAAATACTTCGG - Intronic
1096031089 12:48415759-48415781 TAGAAAATGGTCAAATGGTCAGG - Intergenic
1097857491 12:64480065-64480087 CAGAAAATGGACCAATTGACTGG + Exonic
1099386242 12:82017186-82017208 GAGAAAATGGACTAATACATGGG + Intergenic
1099624571 12:85053580-85053602 CAGAAAATGGAGGAAGAGTCAGG - Intronic
1100006373 12:89900205-89900227 CATAAAATGCACACATACTGAGG - Intergenic
1100181737 12:92093390-92093412 CAGACAATGAACTAATATTCAGG - Intronic
1100268655 12:93002539-93002561 GAGAAAGTCGACAAATGCTCTGG + Intergenic
1100441535 12:94621800-94621822 CAGAAACTGCACAGATACTGGGG - Intronic
1100711213 12:97259024-97259046 CAGAAATTGAACAACTACTGTGG - Intergenic
1100927548 12:99566843-99566865 CAGAAAATGGACTAAGACATAGG + Intronic
1101143480 12:101819366-101819388 ATGAAAATGGACTAATACACTGG + Intronic
1103317710 12:120070206-120070228 TAGAAAATGTACGAATACTTTGG - Intronic
1104296910 12:127524006-127524028 TTGAAAATGGACAAATACAGGGG + Intergenic
1106121130 13:26860910-26860932 ATGAAAATGGACTAATACACTGG - Intergenic
1107258971 13:38467911-38467933 CAGAAAAGGGACAAACAAGCAGG - Intergenic
1107574961 13:41708579-41708601 GAAAATATGTACAAATACTCAGG - Intronic
1108266424 13:48713501-48713523 AAGAAAATGGACTAATACACAGG - Intergenic
1108451251 13:50566790-50566812 CAGAAAATGTGCAGATAATCAGG - Intronic
1109285770 13:60406680-60406702 CAGAAAATGGACATATCTTTTGG + Intronic
1109821225 13:67657939-67657961 GAGCAAATCTACAAATACTCTGG + Intergenic
1111228569 13:85309530-85309552 AAGAAAATGAACAAACAGTCTGG - Intergenic
1111294405 13:86260214-86260236 GAGAAAATGAACAAATATTATGG - Intergenic
1111348610 13:86996488-86996510 CAGAAAATTAACAGATATTCAGG + Intergenic
1111794121 13:92895990-92896012 CAGAAAATGGACCAAGACACTGG - Intergenic
1112874686 13:104021904-104021926 GAAAAAATGGAGAAATGCTCAGG - Intergenic
1112991206 13:105515773-105515795 CAGACACTGGACAAAGACACTGG + Intergenic
1113108070 13:106792438-106792460 CACAAAATGGACTAAGACACTGG - Intergenic
1113313088 13:109151525-109151547 CAGGTAATGCACAAATTCTCAGG - Intronic
1113501951 13:110782731-110782753 ATGAAAATGGACTAATACACTGG - Intergenic
1113703996 13:112413794-112413816 CACAAAAGGGACTAATACTTAGG - Intronic
1115076806 14:29402914-29402936 ATGAAAATGGACTAATACACTGG - Intergenic
1115102416 14:29718485-29718507 GTGAAAATGGACTAATACACAGG + Intronic
1115121167 14:29940113-29940135 CAGAAAATGGACAAAAACAGTGG - Intronic
1115782068 14:36780613-36780635 CAGAAAATTCACAAATAATGTGG - Intronic
1116128675 14:40824746-40824768 CAGAAAATTAACAGATATTCAGG + Intergenic
1117271360 14:54146897-54146919 GTGAAAATGGACTAATACACTGG - Intergenic
1117442203 14:55770707-55770729 CAGAAAATGGTCAAATAGGTTGG + Intergenic
1117701396 14:58417257-58417279 GTGAAAATGGACTAATACACTGG + Intronic
1117972456 14:61265565-61265587 CAGAAAATGGACCATCACCCAGG + Intronic
1118048807 14:62004063-62004085 GTGAAAATGGACTAATACACAGG - Intronic
1118540361 14:66816251-66816273 AAGAAAATTAACAAATATTCAGG + Intronic
1119069834 14:71571574-71571596 CAGAAAATGGACTAAGACAAAGG - Intronic
1120760441 14:88280070-88280092 GTGAAAATGGACTAATACACTGG + Intronic
1121255904 14:92530222-92530244 CTGAAAATGCACAAATCCTTGGG + Intronic
1122344597 14:101050742-101050764 CAGAAAATGGACTAACACAGTGG + Intergenic
1122361366 14:101168352-101168374 AAGAAAATGAACAGAGACTCTGG - Intergenic
1123454467 15:20407316-20407338 AGGAAAATGGACAAACACCCCGG - Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1128820212 15:70645410-70645432 CTGAGAATGGACTAATACACGGG - Intergenic
1128968314 15:72084036-72084058 CAGAAAATTAACAGATATTCAGG - Intronic
1128991342 15:72263002-72263024 TAGCAAATTGACATATACTCTGG + Intronic
1129537234 15:76323630-76323652 CAGAAAATACAAAAATCCTCCGG + Intergenic
1130525084 15:84698948-84698970 CACAAAATGGAATACTACTCAGG + Intronic
1130692213 15:86092591-86092613 CACAAAATGGACTAAGACTGAGG - Intergenic
1131848953 15:96517354-96517376 ATGAAAATGGACTAATACACAGG - Intergenic
1133580514 16:7140205-7140227 CAGAAAATGGACAAATTGGGAGG - Intronic
1134823206 16:17263313-17263335 CAGAGAATGGCCAATTCCTCTGG + Intronic
1135124340 16:19795524-19795546 GAGAAAATGAACAAATATTATGG + Intronic
1135226649 16:20665396-20665418 CAGGAAATGGATAAATTCTTGGG + Intronic
1137540854 16:49360592-49360614 CAGAACATGGACAAACACATGGG - Intergenic
1137719241 16:50618317-50618339 CAGAGAATGGACTCAGACTCTGG + Intronic
1137778490 16:51076738-51076760 GAGAAAATGGACTAATACAATGG - Intergenic
1138800586 16:60023290-60023312 CACAAAATGGACAAAGACAATGG - Intergenic
1140403602 16:74692238-74692260 CAGAAAATGGACAAATGCAGGGG + Intronic
1140511910 16:75514764-75514786 ATGAAAATGGACTAATACACAGG + Intergenic
1141315260 16:82956580-82956602 AAGAAAATGGACTTAAACTCGGG - Intronic
1142361293 16:89628584-89628606 GTGAAAATGGACAAATACAGTGG + Intronic
1144594413 17:16555474-16555496 TAGAAAATGGCCCAAGACTCTGG + Intronic
1145968730 17:28941272-28941294 TAGAAAATAGATTAATACTCTGG - Intronic
1146072423 17:29695226-29695248 CAGAAAATGGAGAAAAACCTTGG - Intronic
1146978402 17:37136400-37136422 CATAAAATGGAATATTACTCAGG - Intronic
1148972821 17:51499259-51499281 CAGAAAATGAAGAAAGACTATGG + Intergenic
1149025416 17:52021802-52021824 GAGAAAATGGATAAATTCCCAGG + Intronic
1150655651 17:67037605-67037627 GTGAAAATGGACTAATACTCTGG - Intergenic
1151166612 17:72209357-72209379 CAGATTATGAACAAATACCCAGG + Intergenic
1151650368 17:75464570-75464592 AAGAAAATGAAAAAATACACAGG - Intronic
1153253574 18:3148304-3148326 CAGTGAATGGATAAATACTTTGG + Intronic
1153766204 18:8377055-8377077 CACAAAATGGGCAAATCCCCAGG - Intronic
1155810509 18:30227246-30227268 GTGAAAATGGACTAATACACTGG + Intergenic
1157007669 18:43605000-43605022 CAGAAAATTAACAGATATTCAGG - Intergenic
1158146831 18:54323513-54323535 CAGAAAATGGACTAAGACATTGG + Intergenic
1158833431 18:61304528-61304550 ATGAAAATGGACTAATACACAGG + Intergenic
1160064113 18:75559026-75559048 CAGATCATTTACAAATACTCAGG + Intergenic
1160421459 18:78749828-78749850 CAGAAAATGGACTAAGACAATGG + Intergenic
1160612494 18:80099374-80099396 GTGAAAATGGACTAATACGCTGG - Intergenic
1163555429 19:17989686-17989708 CAGAAAAAGAACAATTCCTCAGG - Intronic
1164208179 19:23075072-23075094 CATAAAATGCACTAATACTGGGG + Intergenic
1164251403 19:23479749-23479771 GAGACAGTGGTCAAATACTCAGG - Intergenic
1164288387 19:23843254-23843276 GAGACAGTGGTCAAATACTCTGG + Intergenic
1164924478 19:32118258-32118280 CAGAAAATTCACAAATACATGGG - Intergenic
1165957304 19:39509236-39509258 CATAAAATGGAAAAATCCTAGGG + Intergenic
1167404686 19:49297732-49297754 CATAAAATGGAATAATACTTAGG + Intronic
1167582521 19:50354361-50354383 CAGAAAATAAACTAATAATCTGG + Intronic
1167976488 19:53230985-53231007 CAAAAAATGGACTAAGACACAGG - Intergenic
925349130 2:3188899-3188921 GAGAAAATGGACAAAGACCCAGG + Intergenic
925457175 2:4025821-4025843 ATGAAAATGAACAAATACACTGG + Intergenic
925724602 2:6860691-6860713 ATGAAAATGGACTAATACACTGG + Intronic
926480886 2:13392281-13392303 AGGAAAATTGACAAATACCCTGG + Intergenic
926926891 2:17996199-17996221 CAGGAAATGGACGAATCCACAGG - Intronic
927092155 2:19720228-19720250 CAGAAGGTAGACAAACACTCAGG + Intergenic
927623453 2:24687463-24687485 GTGAAAATGGACTAATACACTGG - Intronic
929468060 2:42163806-42163828 CAGAAAATGGGCAGAAACCCAGG + Intergenic
930278783 2:49344425-49344447 CAGAAAATGGACAACTTGTTTGG + Intergenic
930511677 2:52353023-52353045 CACAAAACGGACAAAGACACAGG + Intergenic
930676858 2:54211274-54211296 CAAAAAATGAATAAATACTTTGG + Intronic
932013735 2:68003088-68003110 CAGAAAATTAACAGATATTCAGG + Intergenic
932710035 2:74056018-74056040 CAGAAAATGGACTAAGAAACTGG + Intronic
935372016 2:102356856-102356878 CAGAAAAAAGACAAAGGCTCTGG - Intronic
935857191 2:107288023-107288045 CAGACAATGGACTGAAACTCAGG - Intergenic
935927937 2:108090185-108090207 ATGAAAATGGACAAATACAGGGG + Intergenic
936225647 2:110647727-110647749 TAGAAAATGGACAAAAGATCTGG + Intronic
936870671 2:117131756-117131778 CAAAAAATGGGCAAATGATCTGG + Intergenic
939236375 2:139499341-139499363 CAGAAAATTAACAAATATTCAGG + Intergenic
939623617 2:144449758-144449780 CAGGAAAAGGACAAAAACTGGGG + Intronic
940538401 2:154978005-154978027 CACAAAATGGACAAACACAATGG + Intergenic
941033603 2:160541435-160541457 CAGAAAATGTTCAAATAATTAGG - Intergenic
941187814 2:162339412-162339434 CATAAAATAGATAAATACTAGGG + Intronic
941226858 2:162860652-162860674 AAGAAAATGTACACATGCTCAGG + Intergenic
941524845 2:166594625-166594647 CAGAAAATCAACAAAGAGTCTGG + Intergenic
941756073 2:169187727-169187749 CAGAAGATGGGCAAATATTCAGG - Intronic
942131599 2:172885438-172885460 CATGAAATGGACTAATACACAGG - Intronic
943705826 2:191033159-191033181 CAGAAATTGGAGAAATATACAGG + Intronic
945145744 2:206736290-206736312 ATGAAAATGGACTAATACACAGG - Intergenic
945836743 2:214842897-214842919 GTGAAAATGGACTAATACACTGG + Intergenic
946598468 2:221332809-221332831 CAGAAAATAAGCAAATAATCAGG + Intergenic
946866695 2:224047245-224047267 TAGAAACTGGACAAAAACCCGGG - Intergenic
946981313 2:225219023-225219045 ATGAAAATGGACTAATACACTGG - Intergenic
947096519 2:226572964-226572986 ATGAAAATGGACTAATACACGGG + Intergenic
947693388 2:232161210-232161232 TAGAAAATGAACAAATAGGCTGG - Intronic
948126564 2:235568395-235568417 CATAAAACGGAGAAAAACTCTGG - Intronic
1168797604 20:621979-622001 TAGAAGATGTTCAAATACTCTGG + Intergenic
1169786090 20:9360574-9360596 CAGAAAAAGCACAAATAATTGGG - Intronic
1169963162 20:11185360-11185382 CATAGGATGGACTAATACTCAGG - Intergenic
1170666039 20:18386938-18386960 GTGAAAATGGACTAATACACTGG - Intronic
1172250686 20:33477255-33477277 CTGAAAAGGGAGAAAAACTCTGG - Intergenic
1172967485 20:38847651-38847673 AAAAAAATGAACAAATAGTCCGG - Intronic
1173416333 20:42859470-42859492 CAGTAAAAGGAAAAATAATCCGG - Intronic
1174512454 20:51064169-51064191 TAGAAAATGAACAGAAACTCTGG - Intergenic
1175296914 20:57914891-57914913 CAGAATATGGACTAAGACACTGG - Intergenic
1175511550 20:59530966-59530988 CAGAAAATGGAATATTATTCAGG + Intergenic
1175689311 20:61054184-61054206 CAGAAAATGCACACACACTCTGG + Intergenic
1177339242 21:19778943-19778965 CAGAAAATGGACTAAGACACTGG + Intergenic
1177663553 21:24121318-24121340 AAGAAAATGTATAAATATTCAGG + Intergenic
1178751042 21:35303348-35303370 ATGAAAATGGACTAATACACTGG - Intronic
1178977226 21:37230696-37230718 CAGAAAGTGGACAGACAATCCGG + Intronic
1179001132 21:37459419-37459441 AAGAAAATGAACAAATATTTGGG - Intronic
1179562837 21:42227657-42227679 GTGAAAATGGACAAACACACTGG - Intronic
1180008841 21:45036176-45036198 GAGAAAATAGACAAATACATGGG + Intergenic
1181665588 22:24394031-24394053 CAAAAAATGGACTAACACTCAGG - Intronic
1181747653 22:24967005-24967027 CAGAAGCTGGACTAAAACTCAGG - Intronic
1181896334 22:26111126-26111148 CAGAAACTGGACAGTTACTCTGG + Intergenic
1183153674 22:36057401-36057423 ATGAAAATGGACTAATACACTGG - Intergenic
950133089 3:10560877-10560899 CTGAAAAAGGACAGATGCTCTGG - Intronic
951305213 3:21052021-21052043 CAGAAAATTAACAGATATTCAGG + Intergenic
952759333 3:36900019-36900041 CAAAAAATGGAAAAATTATCTGG - Intronic
952853617 3:37749672-37749694 CAGAAAATGGAGAAATGCTAGGG + Intronic
952982017 3:38743841-38743863 CAGAAATTGGACACATAATTTGG - Intronic
953034334 3:39198907-39198929 CAGAAAATGGACTAAGACAATGG + Intergenic
953730966 3:45447710-45447732 CAGAAAATGGAGGAAGACACAGG + Intronic
954006242 3:47593331-47593353 CAGAAAATGCAAAAATTATCCGG - Intronic
954846122 3:53558502-53558524 CATGAAATGGACAAGTTCTCAGG - Intronic
955310222 3:57879485-57879507 AATTAAATGGACAAATACACTGG + Intronic
956305837 3:67824470-67824492 CCCAAAATGAACAAATTCTCAGG - Intergenic
956530519 3:70212772-70212794 GAGAAAATGGGAAAATATTCAGG - Intergenic
956586600 3:70871782-70871804 CAGAAAATGGACTAAGACAAAGG + Intergenic
957167128 3:76689846-76689868 CAGAAATTGGACAAAGAATTTGG - Intronic
957687119 3:83515851-83515873 CATAAAATGAACAAATGTTCAGG + Intergenic
957709314 3:83834548-83834570 CAGAAAATGGACTAACACGTAGG + Intergenic
959388930 3:105748714-105748736 CAGAACCTGAACAAATACTTGGG - Intronic
959506971 3:107166933-107166955 CAGAAAATTGACGGATATTCAGG + Intergenic
959510373 3:107203873-107203895 AAGTAAATGGACAAATATTAAGG - Intergenic
960476131 3:118130912-118130934 CTGAAAATTGAGAACTACTCTGG - Intergenic
960832887 3:121868819-121868841 CAGAAAATCGACACATACATAGG + Intronic
963586472 3:147196272-147196294 TATAAAATGGTCAAATACTAGGG + Intergenic
963685546 3:148429295-148429317 AAGAAAATAGACAAGTATTCAGG - Intergenic
964301191 3:155287093-155287115 CAGAAAATGTACACAAAATCAGG - Intergenic
965367224 3:167815688-167815710 AAGAAAATGGACAAATAAGAAGG - Intronic
966033059 3:175374709-175374731 CAGAAAATGGAAAAATCAGCTGG + Intronic
966045591 3:175544595-175544617 CAGAATAGTGACAAATACACAGG - Intronic
969050311 4:4368418-4368440 CTGAAAATGAACTAATACACTGG + Intronic
970121796 4:12762113-12762135 CAGAAAATGTTCAAACAGTCAGG + Intergenic
970396223 4:15669642-15669664 CAGAAAATGTAACAAAACTCTGG + Intronic
970535948 4:17029930-17029952 ATGAAAATGGACTAATACACAGG - Intergenic
970588092 4:17533626-17533648 CACAAAATGGACTAAGACACTGG + Intergenic
970685491 4:18561986-18562008 CAGAAAATTAACAGATATTCAGG + Intergenic
971649852 4:29257651-29257673 ATGAAAATGGACCAATACTCAGG + Intergenic
972664389 4:41150021-41150043 ATGAAAATGGACTAATACACTGG + Intronic
973150571 4:46882336-46882358 CAGAAAATTAACAAAGATTCAGG - Intronic
973207101 4:47573008-47573030 GGGAAAAGGGACAAATTCTCTGG - Intronic
974620995 4:64354554-64354576 CAGAGAATGAACAAATTCGCTGG + Intronic
974932869 4:68379647-68379669 CAGAAAATACACAAATAAACTGG + Intergenic
976089822 4:81445444-81445466 CAGAAAATGTGCAAATAGTATGG - Intronic
976692032 4:87878715-87878737 CAGAGAATACACACATACTCGGG - Intergenic
977063641 4:92287255-92287277 GTGAAAATGGACTAATACCCTGG - Intergenic
977084198 4:92573855-92573877 CAGTAAATTCACAGATACTCAGG - Intronic
978303082 4:107293033-107293055 CAGAAACTGGACAAATCTTATGG - Intergenic
979560457 4:122096086-122096108 GTGAAAATGGACTAATACGCAGG - Intergenic
979743724 4:124182359-124182381 AAGAGAATGGACTAATACACTGG + Intergenic
979790747 4:124778136-124778158 CAGGAAATGAAGAAATACTTAGG + Intergenic
980340276 4:131535394-131535416 CAGCAAATGGTCCATTACTCAGG - Intergenic
981809684 4:148759706-148759728 ATGAAAATGGACTAATACACGGG - Intergenic
984030357 4:174596635-174596657 CAGTAAATGCACAAATGCCCAGG - Intergenic
984137231 4:175955963-175955985 TTGAAAATAGACAAATACTCGGG + Intronic
984341165 4:178458287-178458309 CACAAACTGGTCAAATTCTCAGG + Intergenic
984419523 4:179502240-179502262 TAAAAAATGGAAAAATAATCTGG - Intergenic
984955919 4:185045463-185045485 CTGAAAATGGATAAAAACACTGG - Intergenic
985041055 4:185892091-185892113 TATAAAATGGAAAAATACTTTGG - Intronic
986237839 5:5928415-5928437 CAGCAAAAGGCCAATTACTCTGG + Intergenic
986461725 5:7979456-7979478 ATGAAAATGGACTAATACACTGG - Intergenic
986671235 5:10144871-10144893 CAGAAAATGGACTAAGACGGTGG + Intergenic
986726045 5:10597634-10597656 CAGAAAATTAACAAATATTCAGG + Intronic
986878062 5:12134788-12134810 CAGAAAATTAACAGATATTCAGG + Intergenic
987415842 5:17661421-17661443 CAGAAAATTAACAGATATTCAGG - Intergenic
987681743 5:21145015-21145037 CAAAATATGAACAAATACTGTGG - Intergenic
987926427 5:24348213-24348235 CATAAAAAGCACAAATACACAGG - Intergenic
989570678 5:42943502-42943524 TAAAAAATGGGCAACTACTCTGG + Intergenic
989773060 5:45168007-45168029 CAGATTATGGATAAATACTTGGG - Intergenic
990077978 5:51874211-51874233 ATGAAAATGGACTAATACACTGG + Intergenic
990336650 5:54779225-54779247 CAGAAAATGAACTAATACAGAGG + Intergenic
990413163 5:55561236-55561258 GAGAAAAGGGAGAAATACCCTGG + Intergenic
990862062 5:60338297-60338319 CAGAAAATGAGCAAAAACCCAGG + Intronic
990975891 5:61561531-61561553 CACACAATGGAAAATTACTCAGG - Intergenic
992154813 5:73944849-73944871 CAGAAAATGGACTAAGACAGAGG + Intergenic
992263642 5:74995234-74995256 TAGAAAATGGACAAAGAATAGGG - Intergenic
992807305 5:80350559-80350581 AAGAAAATGGACTTATACACAGG - Intergenic
992863849 5:80938749-80938771 GTGAAAATGGACTAATACACAGG + Intergenic
994333537 5:98537021-98537043 TAAAAAATGGACAAAATCTCTGG - Intergenic
994978972 5:106847952-106847974 CAGAAAATGGGCAAATTATATGG - Intergenic
995377223 5:111488962-111488984 CAGAATATGGACTAATAGGCAGG - Exonic
995414746 5:111896596-111896618 TGGAAAATGCACAGATACTCCGG - Intronic
995788239 5:115854833-115854855 AAGAAAAGTGACAAATACTGAGG - Intronic
995859828 5:116629494-116629516 CAAAAAATGGACAAATGCAGTGG + Intergenic
995895621 5:117007242-117007264 GTGAAAATGGACTAATACACTGG - Intergenic
997598321 5:135122018-135122040 TAGTAAATGGACTAAAACTCAGG + Intronic
997702758 5:135915528-135915550 CAGAAAATGGACAATAGATCAGG - Intergenic
998914064 5:146995289-146995311 CAGAAACTGGGCAAGTACTGGGG - Intronic
999025407 5:148225054-148225076 AAGAAAATGGACTACTACTTAGG - Intergenic
1000134887 5:158337506-158337528 CAAAAGGAGGACAAATACTCTGG - Intergenic
1000670098 5:164050866-164050888 GAGAAAATGGACAAATTGTGAGG + Intergenic
1000946143 5:167425589-167425611 CATAAAATGCACAAATTCTCAGG - Intronic
1002900934 6:1409113-1409135 CACAAAAGGGCCAAGTACTCAGG + Intergenic
1004286725 6:14328239-14328261 ATGAAAATGGACTAATACACGGG - Intergenic
1006261053 6:32870921-32870943 GAAAAAATGGACAAAGCCTCAGG + Intergenic
1006851379 6:37101343-37101365 GAGAAAGTGGACGACTACTCAGG - Intergenic
1006917338 6:37603063-37603085 CAGATCATGGACAACTTCTCAGG - Intergenic
1007558483 6:42785747-42785769 CAGAATATGGATAAAAACACAGG + Intronic
1007803611 6:44419746-44419768 CAGGAAATGGTTAAATACTGTGG + Intronic
1007975708 6:46099094-46099116 CAGAAAATGGCTAAAAAGTCAGG + Intergenic
1008141237 6:47834924-47834946 GTGAAAATGGACTAATACACTGG - Intergenic
1008747240 6:54686952-54686974 CACAAAATGGACTAAAACACTGG + Intergenic
1009533010 6:64844166-64844188 ATGAAAATGGACTAATACACTGG + Intronic
1010404223 6:75484539-75484561 TAGAAAATAGACCAATACTTGGG + Intronic
1010511974 6:76730817-76730839 ATGAAAATGGACTAATACACAGG + Intergenic
1010547942 6:77181893-77181915 CAGAAAGTGAACAATTGCTCTGG - Intergenic
1010627986 6:78161973-78161995 CAGAAACAAGACAGATACTCAGG - Intergenic
1010766777 6:79784154-79784176 CAGAAAATGGACAGATGCTGGGG - Intergenic
1010844929 6:80694545-80694567 GAGAAAATGGACAAATTCTTTGG - Intergenic
1011531885 6:88331994-88332016 CACAAAATGGACTAACACACCGG - Intergenic
1012091051 6:94897714-94897736 CACAAAATAGACTAATACACTGG - Intergenic
1012177032 6:96100558-96100580 CAAAATATGGACAAGAACTCTGG + Intronic
1012290487 6:97449885-97449907 AATATAATGGAAAAATACTCTGG - Intergenic
1014390669 6:120858662-120858684 GTGAAAATGGACTAATACACTGG - Intergenic
1014497798 6:122148340-122148362 CAGACAATGCACAATTACTAAGG - Intergenic
1014950796 6:127552522-127552544 CAAAATATGGACCAAAACTCAGG + Intronic
1014964658 6:127732419-127732441 CATGAAATGCACAAATACTAAGG + Intronic
1015970849 6:138741453-138741475 CAAGAAAGTGACAAATACTCTGG - Intergenic
1016401296 6:143683662-143683684 AAGGAAATGGATAAATATTCTGG - Intronic
1017429851 6:154360423-154360445 ATGAAAATGGACTAATACACTGG - Intronic
1017767654 6:157620075-157620097 CAGAAAATGGACTAAGACAGAGG - Intronic
1019013480 6:168861876-168861898 CAGAATATGAACAATTTCTCAGG + Intergenic
1020382193 7:7558598-7558620 CAGAAAATTAACAGATATTCAGG + Intergenic
1020523271 7:9222548-9222570 CACAAAGTGAACACATACTCTGG - Intergenic
1020730111 7:11869560-11869582 ATGAAAATGGACAAATTCACAGG - Intergenic
1020875591 7:13689660-13689682 CAGAGGATGGGCACATACTCAGG - Intergenic
1021155978 7:17210344-17210366 CAGAAAAGGTAGAAATACTCTGG - Intergenic
1021350924 7:19593546-19593568 CAGAAAATTAACAGATATTCAGG - Intergenic
1021660494 7:22914583-22914605 CAAAAAATGGGCAAATGGTCTGG + Intergenic
1022158812 7:27687932-27687954 CAGAAAATGTGGAACTACTCAGG - Intergenic
1022171181 7:27833488-27833510 CAGAAAACTGACAAAAACTCTGG - Intronic
1022703478 7:32782395-32782417 ATGAAAATGGACAAATACACAGG - Intergenic
1023021341 7:36014440-36014462 GTGAAAATGGACAAATACAGGGG + Intergenic
1023344043 7:39252921-39252943 CAGAAAATGGACAAATACTCAGG - Intronic
1023515113 7:40994072-40994094 GAGAAAAGTGACAACTACTCAGG + Intergenic
1024157902 7:46644856-46644878 AAAAAAATGGACAGATACTCAGG - Intergenic
1025002554 7:55328902-55328924 CACAAAATGGGCTAATACACCGG + Intergenic
1025843892 7:65178193-65178215 CAGGAATAGGACCAATACTCAGG - Intergenic
1028844696 7:95466643-95466665 ATGAAAATGGACTAATACACTGG - Intergenic
1028869768 7:95756799-95756821 CAGAAAAGGGACAGGTAGTCAGG - Intergenic
1029983444 7:104900462-104900484 CAGAAAATGGCCTAAGAGTCAGG - Intronic
1030459603 7:109816115-109816137 CAGAAAAAGGACTATTACTAGGG - Intergenic
1030759539 7:113333244-113333266 CAGAAAATTGACAGATATTCAGG + Intergenic
1030787018 7:113674830-113674852 GTGAAAATGGACTAATACACAGG - Intergenic
1030854244 7:114532003-114532025 CAGAACCTGGTCAAAAACTCTGG - Intronic
1031480113 7:122268191-122268213 CACAAAATAGAAAAATACTGGGG - Intergenic
1031762698 7:125734462-125734484 CAAAAAATGTACACATACCCAGG + Intergenic
1031807208 7:126322188-126322210 CATTAAATGGGCAAATAATCTGG - Intergenic
1032934438 7:136712663-136712685 TAGAAAAATGACAAAAACTCAGG - Intergenic
1033272268 7:139943271-139943293 CAGAAAATGGGCAACTGGTCAGG - Intronic
1034122326 7:148639093-148639115 ATGAAAATGGACTAATACACTGG - Intergenic
1035826173 8:2646280-2646302 CTGAGAATGGACTAATACACAGG - Intergenic
1038064280 8:23946684-23946706 CCGGAAATGGACAAATTCTTAGG - Intergenic
1039039874 8:33397074-33397096 CAGAAAATGAGAAAAAACTCAGG - Intronic
1039855300 8:41406861-41406883 GTGAAAATGGACTAATACACAGG - Intergenic
1041620544 8:59962847-59962869 AAGAAAGTGGACAGATTCTCTGG + Intergenic
1041684727 8:60632851-60632873 AATAAAATGTACAAATACACAGG - Intergenic
1041813881 8:61944259-61944281 CACAAAATGGACTAAGACACTGG + Intergenic
1042003216 8:64150154-64150176 CAAAAAAGGGACAAATATTATGG - Intergenic
1044671725 8:94688319-94688341 CAGAAACTGGACAATAACACTGG - Intronic
1044810135 8:96052372-96052394 ATGAAAATGGACTAATACACTGG - Intergenic
1050393792 9:5174509-5174531 CAGAAAAGGGACAACTACTTAGG - Intronic
1051792088 9:20816702-20816724 GAGAAAATGAACAAATACAGTGG + Intronic
1051932843 9:22407365-22407387 AAAAAAATGAACAAAAACTCAGG + Intergenic
1053109656 9:35447259-35447281 AACAAATTGGACAAATTCTCAGG + Intergenic
1053266201 9:36715408-36715430 CAGAAAATGAAGAAATACCATGG - Intergenic
1055805281 9:80086027-80086049 TTGAAAATGGACTAATACACTGG + Intergenic
1056197528 9:84242495-84242517 CAGAAAATGGAAAGAAACACTGG - Intergenic
1060035836 9:120254961-120254983 GTGAAAATGGACTAATACACCGG - Intergenic
1060764710 9:126285248-126285270 CAGAAAATGGAAAAACAATCTGG + Intergenic
1061733954 9:132639401-132639423 TAGAAAATGAACAAAGACTGAGG + Intronic
1186177372 X:6938940-6938962 CAGATAATGGATAAGTATTCTGG + Intergenic
1186477831 X:9872192-9872214 CAGAAAATGGACAGATTAACTGG + Intronic
1187783308 X:22854519-22854541 CAGAAAATGGACTAAGATACAGG - Intergenic
1187787958 X:22914690-22914712 CAGAAATTGTGCAAACACTCAGG + Intergenic
1188299812 X:28494689-28494711 CAGAAAATGAACAAAGTATCAGG - Intergenic
1191037471 X:56042408-56042430 CAGAAAATTAACAGATATTCAGG - Intergenic
1192627122 X:72741158-72741180 CAGAAAATCTACAAATATTTGGG - Intergenic
1192654584 X:72979655-72979677 CAGAAAATCTACAAATATTTGGG + Intergenic
1193994591 X:88349354-88349376 CAGGAAATGGATAAATTCCCTGG + Intergenic
1194102378 X:89721914-89721936 CAGAAAATGAACTATTATTCAGG - Intergenic
1194550994 X:95299059-95299081 CAAAAAATGCCCAAATACCCAGG + Intergenic
1195118050 X:101719489-101719511 CAGAAAATAGAAAAATTGTCTGG + Intergenic
1195403207 X:104484091-104484113 ATGAAAATGGACTAATACACTGG + Intergenic
1195504477 X:105641785-105641807 CAAAATATGAACAAATAATCAGG - Intronic
1195831323 X:109062037-109062059 CAGAAAATTAACAGATACTCAGG + Intergenic
1197174008 X:123465626-123465648 AAGAAAATGCACAAATGCTTAGG - Intronic
1197272582 X:124441738-124441760 AAGAAAATGGGAAAATACACTGG + Intronic
1197664054 X:129204217-129204239 CAGAAAATGCACCACTTCTCAGG + Intergenic
1197752208 X:129972799-129972821 CACAAAATGGACAATTCCTGTGG + Intergenic
1198829779 X:140737435-140737457 CAGAGAAATGATAAATACTCAGG - Intergenic
1198840016 X:140846473-140846495 CAGAAAATGGACTAAGACAGGGG - Intergenic
1198843636 X:140885580-140885602 CAGTGAATGTCCAAATACTCAGG - Intergenic
1199032670 X:143018751-143018773 CAAGAAATGGACAAATACTTAGG + Intergenic
1199792052 X:151164468-151164490 CAGAAAACGGACTTATATTCTGG - Intergenic
1199862510 X:151814557-151814579 AAGAGCATGGACAAATACTCTGG + Intergenic
1200454965 Y:3379192-3379214 CAGAAAATGAACTATTATTCAGG - Intergenic
1201412285 Y:13712034-13712056 ATGAAAATGGACTAATACGCTGG + Intergenic