ID: 1023344462

View in Genome Browser
Species Human (GRCh38)
Location 7:39257066-39257088
Sequence CCTTCCATTGAGAGGGTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023344462 Original CRISPR CCTTCCATTGAGAGGGTTGA CGG (reversed) Intronic
907285373 1:53376427-53376449 CCTTCCATGGACAGGGGTGAAGG + Intergenic
910742299 1:90533249-90533271 CGTTCTATTGAGAGGATTCAAGG - Intergenic
911022277 1:93400841-93400863 CAGTCCATTCAGATGGTTGAAGG - Intergenic
911664267 1:100536288-100536310 CTTGCTATTCAGAGGGTTGAAGG - Intergenic
912186849 1:107287600-107287622 TCTTAAATTTAGAGGGTTGATGG + Intronic
915459933 1:156064069-156064091 CCACCCACTGAGAGGGATGAGGG + Intronic
916086596 1:161274846-161274868 CCTTCCACTGAAAGGGGTGCAGG - Intronic
916093874 1:161331116-161331138 CCTTCTGATGAGATGGTTGAGGG + Intronic
918107733 1:181427992-181428014 ACATCCATTGATAGGGTTGCTGG - Intronic
922234104 1:223710467-223710489 CCATCCATTTAGATGGTTGGCGG - Intronic
1063056240 10:2507453-2507475 CCTCCCCTTCAGAGGGATGATGG - Intergenic
1066174047 10:32885514-32885536 CCTTCCATTGATAAGATTTAAGG + Intergenic
1066174417 10:32888650-32888672 CCATACATTGAGAGGGCTGCTGG - Intergenic
1067137538 10:43624640-43624662 CCTCCTCTGGAGAGGGTTGAGGG - Intergenic
1067459416 10:46446388-46446410 CATTCCATGGAGAGGTTGGAGGG + Intergenic
1067627778 10:47938242-47938264 CATTCCATGGAGAGGTTGGAGGG - Intergenic
1070376297 10:75834276-75834298 GCTTCTGTTGAGATGGTTGAGGG + Intronic
1074423975 10:113334852-113334874 CCTGCTCTTGTGAGGGTTGAGGG - Intergenic
1075384357 10:122044370-122044392 CCTTCCCTTGACAGGGAAGATGG + Intronic
1081679922 11:44994918-44994940 CCTAGCATTGAGAAGGTTGAGGG + Intergenic
1085026379 11:73239021-73239043 CCTTCCATGCAGGGCGTTGAGGG + Intergenic
1086003901 11:82013314-82013336 GTGTCCATTCAGAGGGTTGAGGG + Intergenic
1090516124 11:127429149-127429171 CATTCCATTGAGAAGTTTTATGG - Intergenic
1090774012 11:129947318-129947340 CCTTCCATCGAGAGTGTAGATGG - Exonic
1091970413 12:4781885-4781907 GCTCCCATTGAGGGGGTTTAAGG + Intronic
1096050915 12:48606572-48606594 CCCTCCCTTGAGAGGTTTGGAGG - Intergenic
1098229478 12:68358552-68358574 CCTTCCATTGTCATGCTTGATGG - Intergenic
1099269204 12:80486299-80486321 CCTTTCATTGAGAGAGTATAAGG - Intronic
1104951282 12:132441641-132441663 CCTGCCAGCGAGTGGGTTGAGGG + Intergenic
1108640760 13:52380467-52380489 GCTTCCACTGAGAGGATTGGGGG - Intronic
1109419892 13:62098475-62098497 CCTTTCATTGAGAGGCATAAAGG - Intergenic
1115679703 14:35722942-35722964 CATTCCAGGGAGAGGGGTGAGGG - Intronic
1119764890 14:77182019-77182041 CCTTGCATTGGGAGGGATGGGGG + Intronic
1122803282 14:104243516-104243538 CCTGCCATTGAGGGGGCTGATGG + Intergenic
1129686030 15:77686576-77686598 CTTACCTGTGAGAGGGTTGACGG - Intronic
1130956016 15:88628108-88628130 CCTTCCATTGACCTGGTTGGTGG + Intronic
1130997433 15:88911818-88911840 CCTTCCCTGGAGTGGGATGAAGG - Intronic
1135883634 16:26283550-26283572 CCTTGAAATGAGATGGTTGAAGG + Intergenic
1137852844 16:51763425-51763447 CCTGCCACTGAGACGGTTCAGGG + Intergenic
1141661620 16:85444645-85444667 ACATGCATGGAGAGGGTTGAAGG - Intergenic
1143742935 17:8966893-8966915 TCTTCCATTGTGAGGGCTGTCGG - Intergenic
1144543090 17:16165058-16165080 TCTTCCTTTGAGAGTTTTGAAGG + Exonic
1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG + Intergenic
1150206980 17:63416558-63416580 CCTTCCAGTGTCAGGGTTTAGGG - Intronic
1153759396 18:8316162-8316184 CCTTCCCTTGAGAGGCTCCAGGG + Intronic
1155177046 18:23310044-23310066 CCTTCCCTGGAGAGAGATGAGGG - Intronic
1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG + Intronic
1159949873 18:74475164-74475186 CCTTACATGGAGAGGTTTGGGGG - Intergenic
1161841931 19:6687151-6687173 CTCTCCAGTGGGAGGGTTGAGGG + Intronic
1165355483 19:35301202-35301224 AGTTCTAATGAGAGGGTTGAGGG + Intronic
1168237534 19:55072775-55072797 CCTTCGATTGATGGGGATGAAGG - Intronic
925817951 2:7771612-7771634 CCTTCCATGGCAAGGGCTGATGG + Intergenic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
928261706 2:29773649-29773671 CCATCCATTGAGATGGATGATGG + Intronic
934046290 2:88175272-88175294 GCTGCCATTGAGAGTGTTCAAGG + Exonic
935736987 2:106114093-106114115 CCAGCCACTGAGAGGGCTGATGG - Intronic
941714071 2:168745588-168745610 CCTTCCAATTTTAGGGTTGAAGG - Intronic
1169146432 20:3255555-3255577 CCTCTCATTGGTAGGGTTGAGGG - Intronic
1170305645 20:14934898-14934920 CCTCCAATAGAGAGGGCTGAGGG + Intronic
1172526460 20:35602840-35602862 GCTTGCAGTGAGAGGGTTGGGGG - Intergenic
1172802972 20:37591274-37591296 CCTTCCATGTAGAGGGGTCAAGG - Intergenic
1177491203 21:21828455-21828477 GGTTCCATTCAGATGGTTGAAGG + Intergenic
1178897405 21:36570462-36570484 GGTTCCATTCAGATGGTTGAGGG + Intronic
1179119861 21:38533438-38533460 CCTTCATTTTAGAGGATTGAAGG - Intronic
1184843733 22:47068004-47068026 CCTTCCATTGAGAGGGGTCAGGG + Intronic
949581684 3:5394805-5394827 CCTTCCTTTAAGAGGGTGGCTGG + Intergenic
955059911 3:55485415-55485437 TCTTCCGTTGAGAGGGTCGGGGG + Intronic
960023339 3:112980339-112980361 CCTTCAATGAAGGGGGTTGATGG + Intergenic
961505921 3:127370391-127370413 CCTTCCATTAACAGGGTGGTGGG + Intergenic
966575811 3:181501458-181501480 CCTTCCAATGAAAGCATTGATGG - Intergenic
968951967 4:3700011-3700033 CCCTCCAGTGACAAGGTTGACGG + Intergenic
971825361 4:31614410-31614432 CCTGCCATTGGGAGGGTTCCGGG + Intergenic
973944285 4:55941584-55941606 CCTTCCATTGGGCTGCTTGAGGG + Intergenic
986667493 5:10116018-10116040 CCTTCCACTGAGAGTGATGATGG - Intergenic
990749200 5:58994794-58994816 CAGTCCATTGAAATGGTTGAGGG - Intronic
992364517 5:76078231-76078253 CCATCACTTGAGAGGGTTGTGGG + Intergenic
996723238 5:126650051-126650073 CCTTCCACTGAAAGGGCTAAAGG + Intergenic
999258559 5:150223294-150223316 GCCTCCATTGAGAGGGCTGCTGG - Intronic
1000657102 5:163892876-163892898 GGGTCCATTGAGACGGTTGAGGG - Intergenic
1003124038 6:3341004-3341026 CCCTCCCTTCACAGGGTTGAAGG + Intronic
1003382390 6:5637027-5637049 CCTTCAACTGAGAGTGTTTATGG - Intronic
1003427159 6:6005136-6005158 CCTTACTTTGAGAGGTTTGGAGG - Intronic
1003494213 6:6649952-6649974 CCTCCCACTGAGAGGGATGCCGG + Intronic
1007412267 6:41671808-41671830 CCTTCCATTCAGAGAGTAGGGGG + Intergenic
1008696400 6:54043499-54043521 CTTTCTTTAGAGAGGGTTGAGGG - Intronic
1010740316 6:79495251-79495273 TTTTCCATGGACAGGGTTGAGGG - Intronic
1013722818 6:113051274-113051296 CCTGACAAAGAGAGGGTTGATGG + Intergenic
1016374119 6:143403084-143403106 GCATCCATTCAGATGGTTGAGGG + Intergenic
1017519103 6:155186030-155186052 TCTTCCATTTTGAAGGTTGAGGG + Intronic
1018250294 6:161862734-161862756 CCTTCCATTCAGAGGCGAGAAGG + Intronic
1021363713 7:19749633-19749655 CCTTGCATTGAAAGAGATGATGG - Intronic
1023344462 7:39257066-39257088 CCTTCCATTGAGAGGGTTGACGG - Intronic
1025613680 7:63099955-63099977 CCTTCCAGTGAGAAGGTCCAGGG + Intergenic
1027799605 7:82734935-82734957 CCTTTCATTCAGAGGGTTCTGGG - Intergenic
1029612435 7:101634241-101634263 CCTGGCAATGAGAGAGTTGATGG - Intergenic
1033982081 7:147178009-147178031 CCTTCCACAGATAGAGTTGAGGG - Intronic
1035582875 8:751061-751083 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582885 8:751101-751123 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582895 8:751141-751163 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582905 8:751181-751203 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582915 8:751221-751243 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582925 8:751261-751283 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035598431 8:880093-880115 CTTTCCTTTGAGAGGGGTGAGGG + Intergenic
1036556102 8:9861919-9861941 CATTCAATTTAGAGGGTTGTGGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1037931570 8:22883474-22883496 CCTTCCCTGGAGAGGGATGTGGG - Intronic
1039877431 8:41598979-41599001 CCTTCTATTCAGGCGGTTGAAGG + Exonic
1041661383 8:60404900-60404922 CCTTACAATGAGAGGGCTGTTGG - Intergenic
1042361239 8:67885507-67885529 CGGTCCATTCAGATGGTTGAGGG + Intergenic
1049922259 9:376228-376250 CCTCCCATTAAGTGGGCTGAAGG + Exonic
1051374995 9:16393558-16393580 ACTGACATTGTGAGGGTTGAAGG + Intergenic
1052886553 9:33654714-33654736 CCAACCATTGAGATGGTTGTTGG - Intergenic
1053276008 9:36783767-36783789 CCTTCCATTTTGGGGGTTCAGGG - Intergenic
1054850234 9:69839960-69839982 CCAGCTATTCAGAGGGTTGAGGG + Intronic
1056995325 9:91452005-91452027 GCTTCCATTCAGATGGTTGAGGG - Intergenic
1057474846 9:95389832-95389854 CCTGGCATTGAGGGGGTAGAAGG + Intergenic
1058629792 9:106974705-106974727 ACTTCCCTTGAAATGGTTGAAGG + Intronic
1059280132 9:113125803-113125825 GCTTCATTTGAGAGGCTTGAAGG - Intergenic
1059506866 9:114807176-114807198 CCCTGCAGTGAGGGGGTTGAGGG + Intergenic
1062103645 9:134740981-134741003 CCTTCCAGTGAGAGGGGTGCTGG + Intronic
1062731602 9:138113200-138113222 CCTTCTTTTGAGAGGCATGAGGG + Intronic
1185800094 X:3002718-3002740 CCTACTATTAAGAGGGTTTAAGG - Intergenic
1185932850 X:4222065-4222087 CCTTCCATTGTGGAGCTTGAGGG + Intergenic
1191142268 X:57128122-57128144 CCATCTATTTTGAGGGTTGATGG + Intergenic
1191210839 X:57883172-57883194 CCCTCCATTGAGGGGCCTGAGGG + Intergenic
1192159758 X:68775668-68775690 CTTCCCTTTCAGAGGGTTGAGGG - Intergenic
1193566899 X:83087661-83087683 CCTCCCATTCTGAGGGTTGTTGG + Intergenic
1193781010 X:85701356-85701378 GCTTCCACTGAGAAGCTTGAGGG + Intergenic
1194936870 X:99960819-99960841 CCTTCTTTGGAGGGGGTTGAAGG - Intergenic
1195784174 X:108500418-108500440 CCTTTCATTTAGAGCATTGAAGG + Intronic
1199323925 X:146475222-146475244 CCTTCCAGAGACAGGGCTGAAGG + Intergenic
1199522130 X:148748220-148748242 CTTTACACTGAGAGGGTAGAAGG + Intronic
1201319214 Y:12678597-12678619 ACATCCATTCAGATGGTTGAAGG + Intergenic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic