ID: 1023344792

View in Genome Browser
Species Human (GRCh38)
Location 7:39260332-39260354
Sequence TTGTATGTGTATAGAGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 499}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023344792 Original CRISPR TTGTATGTGTATAGAGTGTG TGG (reversed) Intronic
900075110 1:808206-808228 TGGTATATGTGTACAGTGTGTGG - Intergenic
900683202 1:3929557-3929579 GTGTATGTGTGTGGTGTGTGTGG - Intergenic
900683207 1:3929628-3929650 GTGAATGTGTGTAGTGTGTGTGG - Intergenic
900683212 1:3929674-3929696 GTGTATGTGTGTGGTGTGTGTGG - Intergenic
900683218 1:3929847-3929869 GTGTATGTGTGTGGTGTGTGTGG - Intergenic
900683226 1:3930129-3930151 GTGTATGTGTGTGGTGTGTGTGG - Intergenic
901611783 1:10504509-10504531 CTGTTTGTGTGCAGAGTGTGTGG + Intronic
903424406 1:23243112-23243134 GTGTATGTGTGTATAGTGTTAGG - Intergenic
903616850 1:24665749-24665771 TTTTATATGTATTTAGTGTGAGG + Intronic
903969083 1:27107444-27107466 GTGTATGCGTATTGCGTGTGTGG - Intronic
904486185 1:30825827-30825849 GTGTGTGTGTGTAGAGGGTGGGG - Intergenic
905157560 1:35998939-35998961 TTGTTTATGTATATAGTATGAGG + Intronic
905533588 1:38701283-38701305 TGGTATGTGTCTTGACTGTGTGG + Intergenic
905944305 1:41889023-41889045 GTGTGTGTGTGTAGCGTGTGAGG - Intronic
905944310 1:41889094-41889116 TTGTGTGTGTTTGGTGTGTGAGG - Intronic
906726190 1:48046185-48046207 GTGTATGTGCATATAGGGTGTGG + Intergenic
907686985 1:56621854-56621876 TTGTATGTGTATAGAGGAGTGGG + Intronic
907706814 1:56839608-56839630 TTTTATGGGTACAGAGTGGGAGG + Intergenic
908461136 1:64349173-64349195 TTGTGTGTGTATGGTATGTGTGG + Intergenic
909394291 1:75152363-75152385 TTGTATCTGGATGCAGTGTGTGG - Intronic
910137641 1:83991227-83991249 TTTAATGAGTATAGAGTTTGAGG + Intronic
911485204 1:98496977-98496999 TTGAATGTGTATAAAGTGTGTGG + Intergenic
911923195 1:103793491-103793513 GTGTATGTGTATATATTGAGGGG - Intergenic
912581180 1:110722405-110722427 GTGTATGTGTACATGGTGTGGGG + Intergenic
915444840 1:155968799-155968821 TTGTATGTGTGGAGGGGGTGGGG - Intronic
916306650 1:163342676-163342698 ATGTATGTATATAGAGAGAGGGG + Intronic
917876079 1:179288471-179288493 TCGTATGTTTATAGACAGTGAGG - Intergenic
918457353 1:184735813-184735835 GTATATGTGTATGGAGGGTGGGG - Intronic
919977946 1:202625094-202625116 TGGTATGTGTGTGGTGTGTGTGG + Intronic
919977947 1:202625114-202625136 TGGTATGTGTGTCGTGTGTGTGG + Intronic
919977969 1:202625371-202625393 GTGTGTGTGTGTAGTGTGTGTGG + Intronic
920126405 1:203696896-203696918 ATGTGTCTGTATAGTGTGTGTGG + Intronic
920191247 1:204195277-204195299 GTGTATGTGTGTGGTGTGTGTGG - Intronic
920440073 1:205974754-205974776 TTGTGTGTGTATAGTATGTGTGG - Intergenic
922164863 1:223107238-223107260 TGGTCTCTGTATAGAGTGTATGG - Intergenic
922625291 1:227034450-227034472 TGGTATGTGTGTTGAGTGTGAGG - Intronic
923022891 1:230178676-230178698 TTGTATGTGTGTTGGGGGTGGGG - Intronic
924702779 1:246470980-246471002 ATGTATGTGTGTTGTGTGTGGGG + Intronic
1062913892 10:1232881-1232903 TTGTATGTGTGTGGTGTGTGTGG + Intronic
1063019967 10:2117577-2117599 TTATATGGGTATAGAATGGGGGG + Intergenic
1063192608 10:3711254-3711276 TTGCATGTGTGTTGGGTGTGGGG - Intergenic
1065247412 10:23772830-23772852 TTGTTTGTGTATAAAGTTTGAGG - Intronic
1065632885 10:27698652-27698674 TTGGATGTGTTGAGAGTATGTGG + Intronic
1065882996 10:30053197-30053219 TTGTGTGTGTATAAATGGTGGGG + Intronic
1066129637 10:32380094-32380116 GTGTATGTGTGTGGTGTGTGTGG - Intergenic
1067310794 10:45111749-45111771 TTGTATGTGTGGTGTGTGTGGGG + Intergenic
1067414587 10:46093910-46093932 GTGTATGTGTTTGGTGTGTGTGG - Intergenic
1067434648 10:46268465-46268487 GTGTATGTGTTTGGTGTGTGTGG - Intergenic
1067439084 10:46298201-46298223 GTGTATGTGTTTGGTGTGTGTGG + Intronic
1067581372 10:47448454-47448476 TGGTATGTGTGCATAGTGTGTGG + Intergenic
1067848722 10:49741695-49741717 ATGTATGTGTTTGGTGTGTGGGG - Intronic
1067848765 10:49742175-49742197 TGGGGTGTGTATAGTGTGTGTGG - Intronic
1068282528 10:54893544-54893566 GTGTATGTGTTTCGGGTGTGGGG + Intronic
1069340174 10:67400651-67400673 TTGTTTGTGTATATAATTTGGGG - Intronic
1069717811 10:70532200-70532222 AGGTGTGTGAATAGAGTGTGGGG + Intronic
1070337396 10:75467622-75467644 TTGTGTGTGGATAAATTGTGGGG + Intronic
1070548458 10:77471601-77471623 ATGTATATGTATAGTGTGTGTGG - Intronic
1070548461 10:77471675-77471697 GTATGTGTGTATAGTGTGTGTGG - Intronic
1070761293 10:79026014-79026036 GTGTATGTGTTTATACTGTGTGG - Intergenic
1071676819 10:87662560-87662582 ATGTGTGTGTATAGGGGGTGGGG - Intronic
1071749364 10:88457282-88457304 TTGTTTTTGTAAAGAGTTTGGGG + Intronic
1072057698 10:91776663-91776685 TTATTTTTGTATAGAGTGAGTGG + Intergenic
1072131033 10:92494384-92494406 TTTAATGTGGCTAGAGTGTGGGG + Intronic
1072763735 10:98079641-98079663 TCGTGTGTGTATAGAGTTGGGGG + Intergenic
1072957452 10:99899731-99899753 TTTTATCTGTATAGAGTATTAGG - Intronic
1073195515 10:101687676-101687698 TCGTATTTGTATGAAGTGTGTGG - Intronic
1075211499 10:120495003-120495025 TTGTATGTGTGTATTGTGTATGG + Intronic
1075462550 10:122627331-122627353 GTGTGTGTGTATACAGTGTATGG - Intronic
1076138317 10:128060178-128060200 GTGCATGTGTGTAGTGTGTGTGG - Intronic
1076138322 10:128060252-128060274 GTGTGTGTGTATTGTGTGTGTGG - Intronic
1077372120 11:2187525-2187547 TGGTGTGTGTATGGTGTGTGTGG - Intergenic
1077372156 11:2187960-2187982 TGGTATGTGTGGAGTGTGTGGGG - Intergenic
1077838269 11:5944442-5944464 TTGTATGTGTATGGAGAGTGTGG + Intergenic
1078075486 11:8156124-8156146 ATTGATGTGTATTGAGTGTGTGG - Intronic
1078535287 11:12168292-12168314 ATGTATGTGTGTATGGTGTGTGG - Intronic
1079133651 11:17763780-17763802 GTGTGTGTGTATTGTGTGTGTGG - Intronic
1081213269 11:40362087-40362109 TAATTTGTGTATAGAGTGTAAGG - Intronic
1081536668 11:44001819-44001841 GTGTGTGTGTGTAGAGGGTGGGG + Intergenic
1081602412 11:44504383-44504405 GTGTGTGTGTGTAGAGTGTATGG - Intergenic
1081602419 11:44504468-44504490 GTGTGTGTGTGTAGAGTGTATGG - Intergenic
1081602443 11:44504707-44504729 GTGTGTGTGTGTAGAGTGTATGG - Intergenic
1081670900 11:44942048-44942070 TGGTATGTGTGTGGTGTGTGTGG - Intronic
1082775464 11:57241218-57241240 TTGTATATGTCTAGTCTGTGAGG - Intergenic
1082815487 11:57505591-57505613 ATGTATATGTATAACGTGTGGGG + Intronic
1083082748 11:60110838-60110860 TTGTATCTGTAGAGACTTTGAGG + Intergenic
1083325809 11:61872470-61872492 TTGTATGTGTGTGGAGTAGGGGG + Intergenic
1085553247 11:77394988-77395010 TTGGGTGTGGATAGAGTGTAAGG - Intronic
1085628455 11:78091833-78091855 TTGTTTTTGTGTTGAGTGTGAGG + Intergenic
1086330192 11:85746270-85746292 TTGGATTTGTAGAGACTGTGGGG - Intronic
1086344185 11:85879295-85879317 TAGTTTGTGTATAAGGTGTGAGG + Intronic
1087179019 11:95123747-95123769 TTCTATGTGTTTGCAGTGTGAGG - Intronic
1087334905 11:96831304-96831326 TTGTATGTGTGTGTATTGTGGGG + Intergenic
1088682366 11:112254350-112254372 TGGTATTTGTATGGTGTGTGTGG + Intronic
1089013194 11:115146956-115146978 GGGTATGTGTGTGGAGTGTGTGG + Intergenic
1089598760 11:119600021-119600043 TTGTCTGTGGATGGAGTGTGAGG + Intergenic
1089832512 11:121341072-121341094 TTGTATGTGTGTGCAGTGGGTGG - Intergenic
1089996938 11:122917335-122917357 TTGTATGTGGCTAGATTGTGAGG + Intronic
1090135819 11:124198551-124198573 TTTTATGGGTACAGGGTGTGGGG - Intergenic
1090302558 11:125657282-125657304 TTTAATGTGTACAGTGTGTGTGG + Intronic
1091139636 11:133223987-133224009 GTGTATTTGGGTAGAGTGTGTGG + Intronic
1091215950 11:133902042-133902064 TGGTATGTGTGTATTGTGTGTGG - Intergenic
1091332322 11:134739589-134739611 GTGTATGTGTGTAGTGTGTGTGG + Intergenic
1091332367 11:134740039-134740061 TAGTATGTGTTTGGTGTGTGCGG + Intergenic
1092810310 12:12266603-12266625 TTGTATGTGTCTAGGGGGAGGGG - Intronic
1094179976 12:27581990-27582012 GTGTGTGTGTATGGAGTTTGTGG + Intronic
1096973664 12:55686164-55686186 GTGCATGTGTCTAGTGTGTGTGG - Intronic
1097184976 12:57191727-57191749 GTGTATGTGTATGTGGTGTGTGG - Intronic
1097977486 12:65702848-65702870 GTGTCTGTGTGTAGTGTGTGTGG - Intergenic
1098254640 12:68604708-68604730 ATGTATGTATATATAGTGTATGG - Intergenic
1098533191 12:71564906-71564928 ATATATGTATATATAGTGTGTGG - Intronic
1100607598 12:96164601-96164623 GTGCATGTGTGTAGTGTGTGTGG - Intergenic
1101845960 12:108363176-108363198 TGGTGTGTGTGTGGAGTGTGGGG + Intergenic
1101846018 12:108363650-108363672 GTGTATGTGTGTGGTGTGTGTGG + Intergenic
1102547116 12:113665206-113665228 CTGTGTGTGTATAGGGGGTGAGG - Intergenic
1102554130 12:113714817-113714839 GTGTATGTGTGTGTAGTGTGAGG - Intergenic
1103007622 12:117434738-117434760 GTGTGTGTATATAGTGTGTGAGG - Intronic
1103143756 12:118575760-118575782 GTGTATGTGTATATGGTGTGTGG + Intergenic
1103606834 12:122093035-122093057 GTGTGTGTGTATGGTGTGTGTGG + Intronic
1103606970 12:122094124-122094146 TGGTATGTGTGTGGGGTGTGTGG + Intronic
1103797081 12:123510491-123510513 ATGTGTGTGTGTAGTGTGTGAGG + Intronic
1103797092 12:123510632-123510654 ATGTGTGTGTGTAGTGTGTGAGG + Intronic
1103797105 12:123510797-123510819 ATGTGTGTGTGTAGTGTGTGAGG + Intronic
1103797260 12:123512852-123512874 TTGTGTGTGTGTGGTGTGTGAGG + Intronic
1104908064 12:132225905-132225927 TTGTATATGTACAGTGTGTGGGG - Intronic
1104908156 12:132226462-132226484 GTGCATGTGTACAGTGTGTGGGG - Intronic
1105450774 13:20497333-20497355 TGGTGTGTGTGTAGTGTGTGTGG - Intronic
1105611171 13:21970929-21970951 ATGTGTGTGTATATGGTGTGTGG + Intergenic
1105765742 13:23557208-23557230 TTGTGTGTGTGTGGTGTGTGTGG + Intergenic
1105765744 13:23557258-23557280 TAGCATGTGTGTATAGTGTGAGG + Intergenic
1105765844 13:23558388-23558410 TTGTATGTGTGTGAGGTGTGTGG + Intergenic
1106010017 13:25811448-25811470 GTGTATGTATATACAGTGTATGG + Intronic
1106335212 13:28777604-28777626 TAGTTTTTGTATATAGTGTGAGG + Intergenic
1106391405 13:29338672-29338694 TAGTTTTTGTATATAGTGTGAGG + Intronic
1106878152 13:34098641-34098663 TTTTATGTGGACAAAGTGTGGGG + Intergenic
1107462040 13:40613585-40613607 TTTTATGTGTACAGGGAGTGTGG + Intronic
1109281002 13:60355628-60355650 TTGTTTGCATTTAGAGTGTGGGG - Intergenic
1110195680 13:72785302-72785324 TTGTCTGTGAATAGACTATGAGG + Intronic
1110747864 13:79077426-79077448 ACGTATGTGTATATAGTGTTTGG + Intergenic
1111472243 13:88697673-88697695 TTGTATCCATATAGAGTGAGGGG + Intergenic
1111588654 13:90314455-90314477 GTGTGTGTGTATTGTGTGTGTGG - Intergenic
1111744775 13:92253917-92253939 TGGAATGTCTATAGAGTGTCAGG + Intronic
1111875678 13:93892150-93892172 GTGTATGTATATTGTGTGTGTGG + Intronic
1112623964 13:101081322-101081344 TTGCCTGTGTGAAGAGTGTGGGG + Intronic
1112795529 13:103052439-103052461 TTATATGTGTGTAGAGAGAGAGG - Intronic
1112949079 13:104968598-104968620 TTTTATTTGTACAGAGAGTGAGG + Intergenic
1113210963 13:107980315-107980337 TTGTTTGTGTATAGCTGGTGGGG + Intergenic
1113888235 13:113672233-113672255 GTGTATGTGTGTGCAGTGTGTGG + Intronic
1114483816 14:23051480-23051502 TTGTATGTGTTTTGTGTATGTGG - Intronic
1117748064 14:58891654-58891676 TTTTAAGTGCATAGAGGGTGGGG - Intergenic
1118441689 14:65817718-65817740 TGGTGTGTGTATGGAATGTGTGG - Intergenic
1118441742 14:65818481-65818503 GTATGTGTGTATAGTGTGTGTGG - Intergenic
1119956624 14:78805265-78805287 TTGTTTGTGTATTGTGTGTTTGG + Intronic
1120495079 14:85224847-85224869 TTGCATGTCTACAGTGTGTGAGG + Intergenic
1120904280 14:89606888-89606910 TTTTTTGTGTATAGTGTGTGAGG - Intronic
1121133982 14:91478012-91478034 GTGTATGTGTATTTAGAGTGAGG - Intronic
1121563296 14:94890158-94890180 AGGTATGTGTGTAGTGTGTGTGG + Intergenic
1121563307 14:94890256-94890278 GTGTATGTGTGTGGTGTGTGTGG + Intergenic
1121733960 14:96205211-96205233 TTGTGTGTGTCCAGTGTGTGAGG + Intronic
1124121558 15:26893185-26893207 GTGTGTGTGTATAGTGTGTTGGG + Intronic
1124250769 15:28105331-28105353 GTGCATGTGTGTAGTGTGTGTGG + Intergenic
1124344801 15:28915017-28915039 TGGTATGTGTGTGGTGTGTGTGG - Intronic
1124344885 15:28915623-28915645 TGGTATGTGTATAGTGTGTGTGG - Intronic
1125415786 15:39450803-39450825 TTGTTTCTGTGTAGAATGTGAGG - Intergenic
1126373509 15:47971542-47971564 TTGTCTGTGTATCCAGAGTGAGG - Intergenic
1126975022 15:54167645-54167667 TTGTATGTGGATGGTGTGAGAGG - Intronic
1127543487 15:59966800-59966822 ATAAATGTGTATAGAGTGTAAGG - Intergenic
1127565880 15:60187649-60187671 TTTTCTGTGTGTAGAGTCTGAGG - Intergenic
1128028272 15:64458116-64458138 ATGGATGTGTATATAGTGAGTGG + Intergenic
1128651895 15:69422349-69422371 TAGTATGGATATACAGTGTGAGG + Exonic
1128875740 15:71199726-71199748 TAGTGTGTGTGTAGTGTGTGTGG + Intronic
1129580676 15:76806206-76806228 TAATATCTGTATACAGTGTGAGG + Intronic
1129657860 15:77536648-77536670 TTGTGTGTGTGTAGAGAGAGAGG + Intergenic
1129688448 15:77699587-77699609 TAGTATGTGTTTACTGTGTGCGG - Intronic
1129768161 15:78183141-78183163 TTCTATGTGCAGAGAGTGAGTGG + Intronic
1129894315 15:79092191-79092213 TGGTGTGTGTGTAGGGTGTGTGG - Intergenic
1131044685 15:89304727-89304749 AGGTATGTGTACAGGGTGTGTGG - Intronic
1131828608 15:96340404-96340426 TTGTATATGTTTAGAGTGGCCGG + Intergenic
1131981770 15:98001199-98001221 ATGTATGTGTGCTGAGTGTGTGG + Intergenic
1132326076 15:100971605-100971627 TGTTATGTGTATATAGTATGTGG + Intronic
1133568559 16:7019096-7019118 GTGTATGTGTAAAGACTGAGAGG + Intronic
1133575811 16:7088130-7088152 GTGTATGTGTATGGGGTTTGGGG + Intronic
1133908163 16:10040113-10040135 GTGAATGTGTGTAGTGTGTGCGG - Intronic
1134145708 16:11759769-11759791 GTGTATGTGTGTAGAGAGTGTGG - Intronic
1135474759 16:22764224-22764246 TTGTGTGTAAAGAGAGTGTGTGG - Intergenic
1136115119 16:28089549-28089571 GTGTATGTGTGTGGTGTGTGTGG - Intergenic
1136653567 16:31694545-31694567 GTGTATCTGTGTAGTGTGTGTGG - Intergenic
1139174030 16:64665182-64665204 GTGTGTGTGTATAGAGAGAGAGG - Intergenic
1140037838 16:71384480-71384502 TTGTGTGTGTGTGGTGTGTGTGG - Intronic
1141158774 16:81615307-81615329 GTGTGTGTGTATGGTGTGTGTGG + Intronic
1141233758 16:82196477-82196499 CTTTCTGTGGATAGAGTGTGAGG + Intergenic
1142815683 17:2423181-2423203 TTGTGTATGTATGCAGTGTGAGG - Intronic
1143296173 17:5873686-5873708 TTGTGAGTGTGAAGAGTGTGGGG + Intronic
1146071999 17:29690905-29690927 GTGTGTGTGTAAAGAGTGAGAGG - Intronic
1146665390 17:34699163-34699185 GTGCATGTGGATAGAGTGGGAGG + Intergenic
1147582114 17:41633080-41633102 GTGTATGTGTATGGTCTGTGTGG + Intergenic
1148881211 17:50728913-50728935 TTGTATGTGTATGGCATTTGAGG + Intronic
1152318021 17:79592099-79592121 GTGTGTGTGTGTAGTGTGTGTGG + Intergenic
1152394590 17:80024534-80024556 GTGTGTGTGTATATGGTGTGTGG - Intronic
1152394600 17:80024636-80024658 GTGTATGTCTATGGTGTGTGTGG - Intronic
1152474886 17:80511778-80511800 GTGTGTGTGGATTGAGTGTGGGG - Intergenic
1152607612 17:81300716-81300738 GTGTCTATGTATAGTGTGTGTGG + Intergenic
1152695722 17:81793462-81793484 GTGTATGTGTGTTGTGTGTGTGG - Intergenic
1152903653 17:82958801-82958823 GTGTGTGTGTATACTGTGTGGGG + Intronic
1152903668 17:82958895-82958917 GTGTGTGTGTATACTGTGTGGGG + Intronic
1152903673 17:82958929-82958951 GTGTGTGTGTATACTGTGTGGGG + Intronic
1152903682 17:82958992-82959014 GTGTGTGTGTATACTGTGTGGGG + Intronic
1153894035 18:9543059-9543081 GTGCCTGTGTGTAGAGTGTGTGG - Intergenic
1156311752 18:35929296-35929318 GAGTTTGTGTATAAAGTGTGAGG - Intergenic
1156441408 18:37192181-37192203 GTGTATGTGTGTTGCGTGTGTGG + Intronic
1156974662 18:43205314-43205336 TTGTATTTGTCTATAATGTGTGG + Intergenic
1157017522 18:43735119-43735141 TTTTATGTGAATACAATGTGGGG - Intergenic
1157398967 18:47370800-47370822 TGGGATGTGTATATAGTGTCAGG - Intergenic
1157652183 18:49344730-49344752 TTATTTTTGTATAGAGTCTGTGG - Intronic
1158560895 18:58512762-58512784 GTGTATGTGTGTGGTGTGTGTGG + Intronic
1158560907 18:58512864-58512886 TTGTATGTGTGGTGTGTGTGGGG + Intronic
1160209638 18:76866173-76866195 TTGTTTGTGTTGAGTGTGTGTGG - Intronic
1160393037 18:78549445-78549467 GTGCATGTGTATAGTATGTGAGG - Intergenic
1160400350 18:78606293-78606315 ATGTGTGTGTGTAGTGTGTGTGG - Intergenic
1160400359 18:78606346-78606368 TTGTGTGTGTGGAGGGTGTGCGG - Intergenic
1160415071 18:78704095-78704117 TATTATGTGTGTAGTGTGTGTGG + Intergenic
1160443087 18:78907489-78907511 TTGGATGTGTCTACAGTATGTGG - Intergenic
1161244840 19:3244373-3244395 CTGTATGTGTGTAGTGTGTGTGG + Intronic
1161244841 19:3244410-3244432 GTGTATGTGTGTGTAGTGTGTGG + Intronic
1163111459 19:15163338-15163360 TAGTGTTTGTATAAAGTGTGAGG - Intronic
1165354955 19:35298800-35298822 ATGTATGTGTGCAGTGTGTGTGG - Intronic
1166644499 19:44520976-44520998 TTGTGTGTATGGAGAGTGTGTGG + Intronic
1167116167 19:47490363-47490385 TGGTGTGTGTGTAGTGTGTGTGG + Intronic
1168305800 19:55434542-55434564 TTGTGTGTGTATGGTGTGTGTGG + Intronic
1168305826 19:55434770-55434792 TGGTGTGTGTATGGTGTGTGTGG + Intronic
1168305861 19:55435158-55435180 GTGTGTGTGTATGGTGTGTGTGG + Intronic
925291276 2:2750105-2750127 GTGTATGTGTAGTGTGTGTGTGG + Intergenic
925341192 2:3138061-3138083 GTGCATGTGTGTAGATTGTGTGG - Intergenic
925951217 2:8913414-8913436 TTAGATGTATATAGATTGTGAGG - Intronic
926165201 2:10518518-10518540 CTGTGTGTGTATGGTGTGTGTGG - Intergenic
926591673 2:14746178-14746200 ATGTATGTGTGTGGCGTGTGTGG - Intergenic
927100491 2:19784139-19784161 TGGTATGTGTTTGTAGTGTGGGG - Intergenic
927388639 2:22566742-22566764 TTGCGTGTGAATAAAGTGTGAGG - Intergenic
928589292 2:32797585-32797607 TAGCATGTGTATACAGTGTTAGG - Intronic
928755542 2:34521125-34521147 ATGTATGTGTGTGTAGTGTGTGG - Intergenic
929279200 2:40059840-40059862 ATGTATGTGTATAGATTGCTGGG - Intergenic
929575277 2:43047835-43047857 GTGAATGTGTATTTAGTGTGTGG - Intergenic
929630802 2:43459969-43459991 TTTTATGTGTTTTGAGTTTGAGG - Intronic
930003489 2:46877961-46877983 TGGTATGTGTGTGGTGTGTGTGG - Intergenic
930147697 2:48024071-48024093 TTTTATATATATATAGTGTGTGG - Intergenic
931503210 2:62894416-62894438 GTGTATGTGTGTAGTGAGTGGGG + Intronic
931592580 2:63901621-63901643 TTGTATGAGAATAGGGTTTGGGG - Intronic
931683919 2:64776750-64776772 TTGTATCTGTATATAAAGTGAGG - Intergenic
931786456 2:65623268-65623290 TTGGCTGTGGATAGAGAGTGGGG + Intergenic
931978808 2:67671943-67671965 CTGTGTGTGTATTGTGTGTGTGG - Intergenic
931978852 2:67672715-67672737 TTGTGTGTGTAGTGTGTGTGTGG - Intergenic
932710055 2:74056226-74056248 TAGTCTGTGTGTAGAGAGTGTGG + Intronic
933566514 2:83957163-83957185 TTGGATGTATATAGACTATGTGG - Intergenic
933648254 2:84829417-84829439 TTGTGTGTGTGTAGTGTGTGTGG - Intronic
935063117 2:99624958-99624980 TTGTGTGTGTCAAGTGTGTGTGG - Intronic
935596411 2:104881566-104881588 GTGTATGTGTGTAGAGAGAGAGG - Intergenic
936412441 2:112272619-112272641 TTTTGTGTGGATAGAGGGTGGGG + Intergenic
937082496 2:119150306-119150328 TTGTATGTGTGTGGTGTGTGTGG - Intergenic
937670754 2:124535078-124535100 TTTTATATGTATAGATTGTGAGG - Intronic
938787212 2:134641314-134641336 TAGTATTTGTATATGGTGTGAGG - Intronic
938966570 2:136394026-136394048 TTGTCTGGGTGTGGAGTGTGGGG + Intergenic
939705525 2:145447932-145447954 TTGGATGGGCATAGAGTGTGCGG - Intergenic
939966119 2:148612104-148612126 TTGTATTTGTATTGATTGGGTGG + Intergenic
940795971 2:158079244-158079266 TAGTATGTGTATATATTATGGGG - Intronic
942123150 2:172798720-172798742 TTGTATGTGTATTGAAGTTGTGG + Intronic
942280769 2:174361874-174361896 TTGTATATGTATAGTGTATCTGG + Intronic
942605690 2:177688112-177688134 TTGTAAGTGTATGGACAGTGGGG + Intronic
942962376 2:181847084-181847106 TTGTTTTTGTATAGCCTGTGTGG + Intergenic
943197563 2:184774141-184774163 TTTGATATGTATATAGTGTGGGG + Intronic
943619009 2:190126538-190126560 TTATATGTATTTAGAATGTGAGG - Intronic
944422165 2:199542999-199543021 ATGTATGTGTATGGAATCTGTGG - Intergenic
946075315 2:217069142-217069164 TGGTATGCGTATGGTGTGTGTGG + Intergenic
946155755 2:217805602-217805624 GTGTATGTGTGTGGTGTGTGTGG - Intronic
947398867 2:229713696-229713718 CTGTGTGTGTAAAGGGTGTGCGG - Intronic
947845242 2:233238541-233238563 TTGAATGTATACAGTGTGTGAGG - Intronic
947994312 2:234514289-234514311 TGGTATGTGTGTGGTGTGTGGGG + Intergenic
948501885 2:238400750-238400772 GTATATGTGAATAGAGTTTGGGG + Exonic
948753804 2:240147141-240147163 ATGTCTGTGTATTGTGTGTGTGG + Intergenic
949044340 2:241864375-241864397 TGGTGTGTGTGTAGTGTGTGTGG + Intergenic
1168878760 20:1188447-1188469 TAGTGTGTGTAGAGTGTGTGTGG - Intronic
1168878767 20:1188591-1188613 TAGTATGTGTATTGTGTGTATGG - Intronic
1168878770 20:1188648-1188670 TGGTGTGTGTGTAGTGTGTGTGG - Intronic
1169058911 20:2646429-2646451 AGGTTTGTTTATAGAGTGTGAGG + Intergenic
1169159008 20:3360416-3360438 ATGTATGTGTAAACAGTTTGGGG - Intronic
1170697365 20:18671300-18671322 TTGTAGTTGTAAAGAGTCTGGGG + Intronic
1171429002 20:25067586-25067608 TGGTATGTGTAATGTGTGTGTGG - Intergenic
1172457459 20:35089226-35089248 TTATATATGTATATAGTTTGAGG + Intronic
1172496820 20:35392524-35392546 TTGTATGTGTGTAGATGGTAGGG - Intronic
1172730419 20:37082459-37082481 TTGTATGTGTATGGTGTTGGTGG - Intronic
1172904135 20:38356288-38356310 TTGTGTGTGTAGGGTGTGTGTGG - Intronic
1173090248 20:39963919-39963941 TGGTATGTATATAGAGTATCCGG - Intergenic
1175164267 20:57031901-57031923 GTGTATGTGTGTGGTGTGTGTGG + Intergenic
1175793237 20:61755755-61755777 GTATATGTGTGTAGTGTGTGTGG - Intronic
1175928764 20:62483736-62483758 ATGTATGTGCATTAAGTGTGGGG - Intergenic
1176260997 20:64180001-64180023 TAGCATGTGTGTAGCGTGTGTGG - Intronic
1176372382 21:6069892-6069914 TTGTGTGTATATGGGGTGTGTGG - Intergenic
1176372386 21:6069932-6069954 TTGTGTGTATATGGGGTGTGTGG - Intergenic
1176372422 21:6070302-6070324 GTGTGTGTGTATGGTGTGTGTGG + Intergenic
1176429245 21:6565988-6566010 TGGTGTGTGTGTGGAGTGTGTGG - Intergenic
1176429259 21:6566110-6566132 TGGTGTGTGTGTGGAGTGTGTGG - Intergenic
1176429261 21:6566130-6566152 TGGTGTGTGTGTGGAGTGTGTGG - Intergenic
1176429274 21:6566256-6566278 GTGTGTGTGTGTGGAGTGTGTGG - Intergenic
1176701990 21:10064683-10064705 ATGAATCTGTATAGAGTCTGAGG + Intergenic
1177946895 21:27481542-27481564 TTGTATTTATATGGAGTGTGGGG + Intergenic
1178893427 21:36539486-36539508 GTGTGTGTGTGCAGAGTGTGTGG + Intronic
1179279201 21:39919688-39919710 GTGTATGTCTATGGTGTGTGTGG + Intronic
1179391245 21:40993955-40993977 TTGTGTTTGTATGGTGTGTGTGG - Intergenic
1179433018 21:41337907-41337929 GTGTATGTTTATAGTGTATGTGG + Intronic
1179556774 21:42183713-42183735 TGGTATGTGTATGAGGTGTGTGG + Intergenic
1179556806 21:42184113-42184135 TTGTGTGTGTATGGTGTGAGTGG + Intergenic
1179573638 21:42293042-42293064 TGGTATGTGTGTAGTGTGTGTGG - Intronic
1179573649 21:42293200-42293222 TAGTGTGTGTATGCAGTGTGTGG - Intronic
1179704666 21:43173718-43173740 GTGTGTGTGTGTGGAGTGTGTGG - Intergenic
1179751096 21:43468237-43468259 GTGTGTGTGTATGGTGTGTGTGG - Intergenic
1179751132 21:43468607-43468629 TTGTGTGTATATGGGGTGTGTGG + Intergenic
1179751136 21:43468647-43468669 TTGTGTGTATATGGGGTGTGTGG + Intergenic
1179769567 21:43604388-43604410 TGGTGTGTGTGTAGTGTGTGTGG - Intronic
1179827470 21:43974716-43974738 TTGTATGTGTTTGATGTGTGTGG + Intronic
1180009865 21:45042180-45042202 GTGTATGTGTGTAATGTGTGTGG + Intergenic
1181601476 22:23954485-23954507 ATGTATGTGAATTGTGTGTGGGG - Intergenic
1181607030 22:23986850-23986872 ATGTATGTGAATTGTGTGTGGGG + Intergenic
1184335920 22:43853191-43853213 CTGTGTGTGTGTAGTGTGTGTGG - Intronic
1184400186 22:44269199-44269221 GTGTGTGTGTATATATTGTGAGG - Intronic
1184400229 22:44269693-44269715 GTGTATGTGTTGTGAGTGTGTGG - Intronic
1184565838 22:45291418-45291440 TTGTATGTGTGTGGTGTGTGTGG + Intronic
1185013884 22:48332431-48332453 GTGTGTGTGTATGGTGTGTGGGG - Intergenic
1185013890 22:48332481-48332503 TTGTGTGTGTATGGTGTGTGTGG - Intergenic
1185013898 22:48332583-48332605 TGGTATGTGTGTGGAGTGTATGG - Intergenic
1185042197 22:48510775-48510797 TTGGATGTGTATGGACTCTGAGG + Intronic
1185350881 22:50337196-50337218 CTGTGTGGGTATAGTGTGTGTGG + Intergenic
1185350967 22:50337995-50338017 TTGTGTGGGTATAGTGTGTGTGG + Intergenic
1185351043 22:50338812-50338834 GTGTGTGTGTGTAGGGTGTGTGG + Intergenic
1185351086 22:50339205-50339227 TGGTGTGTGTGTAGGGTGTGTGG + Intergenic
1185351105 22:50339403-50339425 TGGTGTGTGTGTAGGGTGTGTGG + Intergenic
1185351127 22:50339635-50339657 TGGTGTGTGTGTAGGGTGTGTGG + Intergenic
1185351168 22:50340015-50340037 TAGTGTGTGTGTAGGGTGTGTGG + Intergenic
949271359 3:2221377-2221399 TAGTATTTGTATATGGTGTGAGG - Intronic
949276271 3:2286239-2286261 TTGTATGTGTATGTTGTGGGGGG - Intronic
950068450 3:10132613-10132635 TTGTATGTCTATTATGTGTGAGG + Intergenic
950204410 3:11067744-11067766 TTTTATGGGTATAGGATGTGGGG - Intergenic
950896699 3:16458620-16458642 TGATATGTAAATAGAGTGTGTGG - Intronic
951397495 3:22187465-22187487 GTGTGTGTGTATAGGGTGAGAGG - Intronic
951613092 3:24513330-24513352 ATGTGTGTGTCTATAGTGTGAGG - Intergenic
951871164 3:27364090-27364112 TTGTGTGTGTGTGGAGAGTGCGG + Intronic
952598256 3:35044953-35044975 ATATATGTATATAGTGTGTGTGG + Intergenic
953193533 3:40711735-40711757 GTGTATGTGGGGAGAGTGTGGGG - Intergenic
955377090 3:58406693-58406715 TTCTATGGGTATAGAGTTTCAGG - Intronic
956571481 3:70701375-70701397 ATGTATGTGTATGGGGGGTGTGG + Intergenic
957635781 3:82782282-82782304 TTGTATTTGTTAAGTGTGTGAGG - Intergenic
957759331 3:84534161-84534183 TTGTATCTGTAAATTGTGTGGGG - Intergenic
957901813 3:86504110-86504132 TTGTTTGCATATAGAGAGTGGGG + Intergenic
957915646 3:86685038-86685060 TAATTTTTGTATAGAGTGTGAGG - Intergenic
958068358 3:88575430-88575452 TTTTATGTGTATATAGAGTAGGG + Intergenic
959551723 3:107666919-107666941 TTTTATGTGTATGGAGGCTGGGG - Intronic
960318841 3:116209587-116209609 TTGTATGTGTGAAGAGTAAGAGG + Intronic
960497425 3:118391899-118391921 TTGTAGGTGTATATATTTTGGGG + Intergenic
961501490 3:127339154-127339176 GTGCATGTGTGTATAGTGTGTGG - Intergenic
961790213 3:129370576-129370598 GTGTATGTGTGTGGTGTGTGTGG + Intergenic
962060802 3:131925224-131925246 TTGTGTGTGTGTAGAGTGCAAGG - Intronic
963986340 3:151599047-151599069 TTCCATGTGGATAGGGTGTGTGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965765528 3:172126238-172126260 TTGTATGTGCTGAGGGTGTGCGG + Intronic
966160364 3:176961324-176961346 TTGGATGTGAACAGTGTGTGGGG - Intergenic
966892077 3:184414675-184414697 GTGTATGTGTGTGGTGTGTGTGG + Intronic
967885052 3:194328007-194328029 TTGTGTGTGTGTGGTGTGTGTGG - Intergenic
967919625 3:194604638-194604660 TTGTATGTGTATAGAGTATCTGG - Intronic
968310864 3:197682110-197682132 TTATATTTGTACAGAATGTGTGG - Intronic
968631203 4:1653016-1653038 TTGTGTGTGTGTAGTGTGTGTGG - Intronic
969290264 4:6234453-6234475 TTGTATGTGTGCGGAGTGTTTGG - Intergenic
969687955 4:8687129-8687151 TGGTATGTGTAGCGTGTGTGTGG + Intergenic
969687962 4:8687218-8687240 GTGTGTGTGTATATTGTGTGTGG + Intergenic
969687966 4:8687258-8687280 GTGTGTGTGTGTAGTGTGTGTGG + Intergenic
969687977 4:8687344-8687366 ATGTGTGTGTGTAGTGTGTGTGG + Intergenic
970185817 4:13451755-13451777 TTGTATTTGTATAGGGTGAGAGG + Intronic
972351872 4:38243632-38243654 TTGTGTGTGTATGGTGTGTGTGG + Intergenic
972406856 4:38754632-38754654 GTGTGTGTGTAGAGAGTGTGTGG - Intergenic
973269213 4:48244179-48244201 GTATATGTGGATTGAGTGTGGGG - Intronic
973567099 4:52199525-52199547 TGGTGTGTGTGTAGGGTGTGGGG + Intergenic
973779409 4:54274074-54274096 GTGTATGTGGATGGAGTGTGGGG + Intronic
973864885 4:55102500-55102522 TTTTGTGTGTCTAGAGCGTGTGG - Exonic
974139073 4:57860780-57860802 CAGTGTGTGTATAGTGTGTGTGG + Intergenic
975605056 4:76147442-76147464 TTGTATGTGTAACCAGTGTTGGG - Intronic
976402098 4:84618955-84618977 TTGTATGTATGTATAATGTGTGG - Intronic
976703098 4:87992562-87992584 TAATATTTGTATAAAGTGTGAGG - Intergenic
980341790 4:131559581-131559603 TTGTAGATGGAAAGAGTGTGGGG - Intergenic
980494487 4:133574229-133574251 GTGTATGTGTGTGGAGTGTGTGG + Intergenic
981048411 4:140286990-140287012 ATGTATGTGTATGGTCTGTGTGG - Intronic
981048462 4:140288016-140288038 TGGTATGTGTGTAAAGTGTGGGG - Intronic
981048488 4:140288494-140288516 GTGTATGTGTGTAGTGTTTGTGG - Intronic
982558289 4:156897445-156897467 GTGTATGTGTAGAGAGAGGGAGG - Intronic
982729706 4:158943143-158943165 TATTATGTTTATAGAGTCTGAGG - Intronic
982822333 4:159956966-159956988 ATGTGTGTGTGGAGAGTGTGGGG - Intergenic
982919700 4:161257099-161257121 CTCTCTGTGTATAGAATGTGCGG - Intergenic
983222329 4:165054927-165054949 TGGTTTGTGTATAGAGTTGGGGG + Intergenic
985625626 5:983845-983867 TGGTGTGTGTGTAGTGTGTGTGG + Intergenic
986092887 5:4527976-4527998 ATGTATGTGTATAGACTATGGGG + Intergenic
986896717 5:12379921-12379943 TTTTTTTTGTATATAGTGTGAGG + Intergenic
989079125 5:37597983-37598005 TTTTATATGTATGTAGTGTGAGG + Intronic
990000701 5:50888332-50888354 ATGTATGTGTTGGGAGTGTGAGG - Intergenic
990442894 5:55864356-55864378 TGGTGTGTGTGTAGTGTGTGTGG - Intronic
990442919 5:55864780-55864802 GTGTGTGTGTAGAGTGTGTGTGG - Intronic
990635508 5:57721601-57721623 TTGTCTGTGTATAGGAAGTGAGG - Intergenic
991051964 5:62282451-62282473 GTGTATGTGTATGGAGGCTGGGG - Intergenic
992415085 5:76544647-76544669 TGTTATGTGTACAGAGTGAGTGG + Intronic
993518834 5:88873038-88873060 GTGTATGTGTGTACGGTGTGGGG - Intronic
993568144 5:89501071-89501093 TTTTATGTGTAGATAGTCTGTGG - Intergenic
995819464 5:116212512-116212534 GTGTGTGTGTGTAGAATGTGAGG + Intronic
996606239 5:125326974-125326996 TTGTAAGTGTATTGTATGTGTGG + Intergenic
996916466 5:128718217-128718239 TTGGAATTGTATAGAGTGTTGGG - Intronic
997781465 5:136663198-136663220 GTGTGTGTGAATAGAGGGTGAGG - Intergenic
998181302 5:139946446-139946468 TAGTTTTTGTATACAGTGTGAGG - Intronic
998272703 5:140721238-140721260 TTGTTTGTTTATAGGATGTGTGG + Intergenic
998273451 5:140728313-140728335 TTGTTTGTTTATAGGATGTGTGG + Intergenic
999179015 5:149655651-149655673 TGGTGTGTGTGTGGAGTGTGTGG - Intergenic
999606385 5:153321458-153321480 ATGTATGTGTCTATGGTGTGAGG + Intergenic
1000555585 5:162721761-162721783 TTTTATGAGTTTGGAGTGTGAGG - Intergenic
1000695330 5:164373866-164373888 GTGTGTGTGTTTAGTGTGTGTGG + Intergenic
1000720184 5:164696228-164696250 TTGTATTTCTGTAGAGTCTGTGG - Intergenic
1000857732 5:166420474-166420496 TTATATGAGTATAAAGTGTCAGG + Intergenic
1001865512 5:175100888-175100910 TTGTATGTGTGTGGGGTGGGGGG - Intergenic
1002054012 5:176588371-176588393 GTGTGTGTGAATTGAGTGTGTGG + Intronic
1003530418 6:6932338-6932360 GTGTGTGTGTATTGTGTGTGTGG - Intergenic
1003907126 6:10712088-10712110 TTTTGAGTGTATAAAGTGTGAGG + Intergenic
1003991502 6:11491181-11491203 GTGTATGTGTATGGTGTGTGCGG + Intergenic
1003991522 6:11491501-11491523 TTGTGTGTGTATGGTGTGTTAGG + Intergenic
1004084288 6:12429453-12429475 GTGTGTGTGCATAAAGTGTGTGG + Intergenic
1004566516 6:16803266-16803288 ATGGATGTCTATAGGGTGTGGGG - Intergenic
1005478593 6:26233653-26233675 CTGTATTTGTAAATAGTGTGGGG - Intergenic
1006109822 6:31737696-31737718 AAGTATGTGTATAGGGGGTGGGG + Intronic
1007065703 6:38988323-38988345 TTGTATGTGTATAAAGTGCTGGG + Intronic
1007639221 6:43323705-43323727 TTGTGTGTGTATAGATTCTTTGG - Intronic
1007697740 6:43744429-43744451 GTGTATGTGTGTATTGTGTGGGG + Intergenic
1009025025 6:57988929-57988951 TTGTATGTGAAGGGAGTGAGGGG - Intergenic
1009200591 6:60740385-60740407 TTGTATGTGAAGGGAGTGAGGGG - Intergenic
1009263703 6:61527898-61527920 TTTTAGGTTAATAGAGTGTGGGG - Intergenic
1010106411 6:72174301-72174323 TTGTAAGAGTATAGGGTTTGGGG + Intronic
1013587501 6:111592594-111592616 TTGTATATGTATAAACCGTGTGG + Intronic
1013726226 6:113099428-113099450 TTTGATGTCTAAAGAGTGTGTGG - Intergenic
1014051912 6:116964628-116964650 GTGTATGTGGAAAGGGTGTGGGG + Intergenic
1014398083 6:120951672-120951694 ATGTTTGTGTATGGAGTGTTGGG - Intergenic
1015064978 6:129013545-129013567 TTGTATGAGCATAGAAGGTGTGG + Intronic
1016536323 6:145110681-145110703 TTGTGTGTGTATACAGTAAGTGG + Intergenic
1018004157 6:159604725-159604747 ATGTATGTGTATGTGGTGTGTGG + Intergenic
1018004162 6:159604816-159604838 ATGTATGTGTATGTGGTGTGTGG + Intergenic
1019053699 6:169204624-169204646 TGATTTGTGTATAGAATGTGAGG + Intergenic
1020673475 7:11149963-11149985 TTGAATGTTTCTAGTGTGTGAGG + Intronic
1022048193 7:26640094-26640116 GTGTATGTGTGTGGTGTGTGTGG - Intronic
1022127012 7:27368311-27368333 GTGTAAGTGTGTAGTGTGTGTGG - Intergenic
1022345816 7:29513445-29513467 TTGTATGCATAGAAAGTGTGTGG - Exonic
1023079745 7:36515572-36515594 TGGTATGTGTGTGGTGTGTGGGG - Intronic
1023267715 7:38425385-38425407 TTGTATAACTATAGAGTATGGGG + Intronic
1023344774 7:39260135-39260157 GTGTATGAGTACAGAGTGTGTGG - Intronic
1023344792 7:39260332-39260354 TTGTATGTGTATAGAGTGTGTGG - Intronic
1024524244 7:50335290-50335312 GTGTATGTGTATGGGATGTGTGG + Intronic
1024524276 7:50335614-50335636 TTATATGTGTATGGGATGTGTGG + Intronic
1027878841 7:83805772-83805794 GTGTATGTATATAAAGTTTGTGG - Intergenic
1028531367 7:91842189-91842211 TTTTATGGGTACAGAATGTGGGG - Intronic
1029224240 7:99013614-99013636 GTGTGTGTGTGGAGAGTGTGCGG + Intergenic
1029299747 7:99571024-99571046 CTGTCTCTGTGTAGAGTGTGAGG + Intronic
1029842492 7:103380850-103380872 GTGTATGTGTGTGGTGTGTGAGG - Intronic
1030308381 7:108042975-108042997 GTGTATGTGTACAGAGAGTAAGG + Intronic
1030552030 7:110973772-110973794 TTGTATGTGTACAGAATTAGGGG - Intronic
1032239837 7:130152101-130152123 TTGTGTGTGTAATGTGTGTGTGG - Intergenic
1032492803 7:132336640-132336662 TTCTTTGTGTATAGAGTGGGGGG - Intronic
1032954437 7:136954166-136954188 ATGTATGTGTATAAAGAATGAGG - Intronic
1033601231 7:142889779-142889801 GTGTATTTCTATAGTGTGTGTGG + Intergenic
1033601237 7:142889820-142889842 GTGTATTTCTATAGTGTGTGTGG + Intergenic
1033601243 7:142889861-142889883 GTGTATTTGTATAGTGTGTGTGG + Intergenic
1033898164 7:146101438-146101460 TTTTATTTCTATAGAGTTTGGGG + Intergenic
1034858283 7:154574660-154574682 GTGTATGTGTGTGGTGTGTGTGG + Intronic
1034858308 7:154575020-154575042 GTGTATGTGTGTGGTGTGTGTGG + Intronic
1034858360 7:154575663-154575685 GTGTATGTGTGTGGTGTGTGTGG + Intronic
1035233630 7:157482852-157482874 TTGTGTGTGTGTTGTGTGTGTGG + Intergenic
1035478976 7:159166727-159166749 TTGTGTGTGTGTTGTGTGTGTGG + Intergenic
1036388144 8:8299501-8299523 TTGTGTGTGTTTCGTGTGTGGGG - Intergenic
1037627638 8:20621898-20621920 TTGTGTGTGTATGGTGTGTGTGG - Intergenic
1037627646 8:20622051-20622073 TTGTATTTGTGTGGTGTGTGTGG - Intergenic
1038411706 8:27364021-27364043 GTGTTTGTATGTAGAGTGTGTGG - Intronic
1038697696 8:29820647-29820669 TTGTGTGTGTGTGGAATGTGTGG - Intergenic
1039610888 8:38918422-38918444 GTGTGTGTGTATGGTGTGTGTGG - Intronic
1040139614 8:43895015-43895037 TTGAATGTGTATAGTGTAGGTGG - Intergenic
1040423090 8:47259314-47259336 TTGTATGTGTGTGCTGTGTGAGG + Intergenic
1040609500 8:48968607-48968629 TGGTGTGTGTGTAGTGTGTGTGG + Intergenic
1041024622 8:53671016-53671038 GTGTATATGTGTAGAGTGTATGG - Intergenic
1041024634 8:53671427-53671449 TAGTGTGTGTATAGTGTATGTGG - Intergenic
1042404439 8:68387442-68387464 TTGAATAGTTATAGAGTGTGAGG + Intronic
1043839621 8:85087163-85087185 TTTTATGTGTATTCAGGGTGGGG + Intergenic
1044940781 8:97341011-97341033 GTGTACGTGTATAGGATGTGAGG - Intergenic
1045383843 8:101652337-101652359 GTGTATGTGTGTGGTGTGTGTGG + Intronic
1045609854 8:103826391-103826413 ATTTTTGTGTATATAGTGTGAGG + Intronic
1046713009 8:117534335-117534357 TTGTGTATCTATTGAGTGTGTGG - Intronic
1048216053 8:132496316-132496338 ATGTATGTGTGCAGTGTGTGTGG + Intergenic
1048293052 8:133194995-133195017 TTGTGTGTGTGTTGTGTGTGTGG + Intronic
1048423688 8:134302872-134302894 TGGTATGTGTATTGTGTGTGTGG + Intergenic
1048848165 8:138619434-138619456 CTGTAAGTGTGTAGTGTGTGTGG - Exonic
1049525555 8:143124791-143124813 ATGCATATGTATACAGTGTGAGG - Intergenic
1050829081 9:9989339-9989361 TTTTATGGGTACAGAATGTGGGG - Intronic
1051021484 9:12548911-12548933 TTGTATGTATATTTAGTGTCTGG - Intergenic
1051255132 9:15205393-15205415 TTGTATGTGTGTGTAGGGTGGGG - Intronic
1052136372 9:24916430-24916452 TTGTTTTTGTAAATAGTGTGAGG + Intergenic
1052395138 9:27929444-27929466 TTGTATGTGGCTAGAGAATGTGG + Intergenic
1053504447 9:38629686-38629708 TGGTGTGTGTGTGGAGTGTGTGG - Intergenic
1054319930 9:63647746-63647768 ATGAATCTGTATAGAGTCTGAGG + Intergenic
1054337821 9:63823254-63823276 TCGTGTGTGTACAGTGTGTGGGG - Intergenic
1056407643 9:86290883-86290905 TTGTATGTGTATGAAGTATGAGG - Intronic
1056655387 9:88504482-88504504 TGGTATGTATATGCAGTGTGTGG + Intergenic
1056675404 9:88672788-88672810 TGGTCTGTGTATATTGTGTGTGG + Intergenic
1056754154 9:89371899-89371921 TGGTATGTGTGTGGTGTGTGGGG + Intronic
1057048683 9:91905300-91905322 TTGTATGTGTGTGGTGTGTCTGG - Intronic
1057112249 9:92484252-92484274 ATGTATGAGAATGGAGTGTGAGG - Intronic
1057564765 9:96157926-96157948 GTGTATGTGTGTGGTGTGTGTGG + Intergenic
1057564773 9:96158013-96158035 GTGTATGTGTGTGGTGTGTGTGG + Intergenic
1058441780 9:105015658-105015680 TTGTATATATATTTAGTGTGTGG + Intergenic
1058551135 9:106116143-106116165 TGGTGTCCGTATAGAGTGTGGGG + Intergenic
1059248063 9:112865119-112865141 GTGTATGTGTAGGGGGTGTGTGG - Intronic
1059248091 9:112865230-112865252 TGGTGTGTGTATGGTGTGTGTGG - Intronic
1059694229 9:116715600-116715622 GTGCATGTGTATGGAGGGTGGGG - Intronic
1061332265 9:129902617-129902639 TTGTATCTGTATACGGTGCGGGG - Intronic
1062119525 9:134826831-134826853 GTGGATGTGTATATGGTGTGTGG + Intronic
1062706688 9:137949057-137949079 AAGTATGTGTGTAGTGTGTGTGG + Intronic
1202784663 9_KI270718v1_random:37491-37513 TTATGTGTGTATACTGTGTGTGG + Intergenic
1202784680 9_KI270718v1_random:37756-37778 ATGTACGTGTACAGTGTGTGGGG + Intergenic
1202784711 9_KI270718v1_random:37999-38021 TGGTGTGTGTACAGTGTGTGGGG + Intergenic
1202787007 9_KI270719v1_random:34776-34798 ATGAATCTGTATAGAGTCTGAGG + Intergenic
1203445543 Un_GL000219v1:51223-51245 GTGTGTGTGTGTAGTGTGTGTGG - Intergenic
1185726796 X:2428242-2428264 TTGTATTTTTATAGATTTTGTGG - Intronic
1187203311 X:17157027-17157049 GTGTATGTGTATGGAGGATGGGG + Intergenic
1188330399 X:28864043-28864065 ATATATGTGTATAGTGTATGTGG - Intronic
1189115459 X:38337717-38337739 GTGTATGGGAATAGAGTGTAAGG - Intronic
1190164461 X:48061233-48061255 TTATTTTTGTATATAGTGTGAGG - Intronic
1190378710 X:49816783-49816805 TTATCTGTGTTTAGGGTGTGAGG - Intergenic
1191043713 X:56113732-56113754 TTGTTTTTGGGTAGAGTGTGTGG + Intergenic
1191671402 X:63751866-63751888 ATGTGTGTGTGTAGGGTGTGTGG - Intronic
1192004961 X:67200600-67200622 TTGCTTTTGTATAGAGTGTGAGG + Intergenic
1192141823 X:68652665-68652687 TTTCATGTGTGTGGAGTGTGGGG - Intronic
1192413500 X:70955903-70955925 TAGTTTTTGTATACAGTGTGAGG - Intergenic
1193873319 X:86829059-86829081 TTTTAAGTGTTTAGAGTGGGTGG - Intronic
1194415997 X:93612811-93612833 TTGTTTTTGTATATAGTGTAAGG + Intergenic
1195317133 X:103690048-103690070 TAATGGGTGTATAGAGTGTGTGG - Intergenic
1197801819 X:130357760-130357782 TTGTATGTGTGCAGAGTCTGTGG + Intronic
1197855760 X:130912240-130912262 TTGTGTGTGTGAAGAGTATGGGG + Intergenic
1198828574 X:140724669-140724691 CTGTGTGTGTATGGAATGTGTGG - Intergenic
1198986397 X:142459090-142459112 GTGTGTGTGTATAGAGGATGGGG - Intergenic
1199151813 X:144496167-144496189 CTGTGTGTGTATAGTGTTTGAGG + Intergenic
1199529831 X:148833723-148833745 TTGTCTGTGAAAAGGGTGTGAGG + Intronic
1200753777 Y:6970901-6970923 TTGGATGTGTAACGTGTGTGTGG + Intronic