ID: 1023352536

View in Genome Browser
Species Human (GRCh38)
Location 7:39334785-39334807
Sequence TCTCTAGAAGAAGAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1559
Summary {0: 1, 1: 0, 2: 7, 3: 119, 4: 1432}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023352536_1023352541 20 Left 1023352536 7:39334785-39334807 CCTGTTTTTTCTTCTTCTAGAGA 0: 1
1: 0
2: 7
3: 119
4: 1432
Right 1023352541 7:39334828-39334850 ACACAATAAATACAGAGTTAGGG 0: 1
1: 0
2: 4
3: 23
4: 323
1023352536_1023352543 29 Left 1023352536 7:39334785-39334807 CCTGTTTTTTCTTCTTCTAGAGA 0: 1
1: 0
2: 7
3: 119
4: 1432
Right 1023352543 7:39334837-39334859 ATACAGAGTTAGGGAGGCAAAGG No data
1023352536_1023352540 19 Left 1023352536 7:39334785-39334807 CCTGTTTTTTCTTCTTCTAGAGA 0: 1
1: 0
2: 7
3: 119
4: 1432
Right 1023352540 7:39334827-39334849 CACACAATAAATACAGAGTTAGG 0: 1
1: 0
2: 2
3: 30
4: 344
1023352536_1023352542 23 Left 1023352536 7:39334785-39334807 CCTGTTTTTTCTTCTTCTAGAGA 0: 1
1: 0
2: 7
3: 119
4: 1432
Right 1023352542 7:39334831-39334853 CAATAAATACAGAGTTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023352536 Original CRISPR TCTCTAGAAGAAGAAAAAAC AGG (reversed) Intronic
900306083 1:2009114-2009136 TCTCAAAAACAAAAAAAAACTGG + Intergenic
900356053 1:2264567-2264589 TCTCTACAAAAAAATAAAACAGG - Intronic
900674069 1:3872994-3873016 TCTCTAAAAGAAAAAGAAAAAGG - Intronic
900748962 1:4381814-4381836 TCTCTGCAAGAAGAAAAATATGG + Intergenic
900967434 1:5968595-5968617 TGTCTCGAAGAAAAAAAAAAAGG + Intronic
901089322 1:6630874-6630896 TCTCTACAAAAAAAAAAAAGTGG - Intronic
901418053 1:9130485-9130507 TCTCTAGAAAAAAAAAAAAAAGG - Intergenic
901486569 1:9567024-9567046 TCTCAAAAAGAAAAAAAAAAGGG + Intronic
901816337 1:11795514-11795536 TCTCTAAAAACAGAAAAAAGAGG - Intronic
901823788 1:11847439-11847461 TCTTTAGAAAAGGAAAATACAGG + Exonic
901850193 1:12010151-12010173 TCTCAAAAAGAAAAAAAAAATGG + Intronic
902317123 1:15630125-15630147 TCGATAGAAGAAGAAAAATAGGG - Intronic
903421918 1:23224047-23224069 TCTCTGCAAGAAGAAAAATATGG + Intergenic
903523137 1:23970360-23970382 TCTCAAAAAAAAAAAAAAACCGG - Exonic
903752653 1:25636494-25636516 TCTCTGCAAGAAGAAAAATATGG + Intronic
904020061 1:27457041-27457063 TCTCTACTAGAAAAAAATACAGG - Intronic
904168742 1:28576153-28576175 TCTCAAAAAAAAAAAAAAACTGG - Intronic
904644997 1:31959003-31959025 TCTCAAGAAAAACAAAAAACAGG - Intergenic
904671617 1:32170342-32170364 TCCTTAGAAGGAGAAGAAACTGG - Intronic
904714721 1:32458855-32458877 TCTCTGCAAGAAGAAAAATATGG - Intergenic
905185861 1:36196512-36196534 TCTCCAGAAAAAAAAAAAAAAGG - Intergenic
905559126 1:38912403-38912425 TCTCAAGAAAAAAAAAAAACGGG - Intronic
905959376 1:42030986-42031008 TGTCTAGATGCAGAAAAACCTGG + Intronic
905996586 1:42386573-42386595 TCTCTATAAAAATAAAAAATTGG + Intronic
906427623 1:45726156-45726178 TCTCTAAAAAAAAAAAAAAATGG + Intronic
906483167 1:46214342-46214364 TCTCAAAAAGAAAAAAAAAAAGG + Intronic
906496438 1:46307343-46307365 TCTCTAAAAAAATTAAAAACAGG - Intronic
906577121 1:46901125-46901147 TCTCTGCAAGAAGAAAAATATGG - Intergenic
907086823 1:51683179-51683201 TCTCAAAAAAAAGAAAAACCTGG - Intronic
907190837 1:52647132-52647154 TCTCTAAAACAAACAAAAACAGG - Intronic
907361398 1:53918837-53918859 TCTCAAAAAAAAGAAAAAATGGG - Intronic
907439564 1:54470804-54470826 TCTCAAAAAAAAGAAAAAAGAGG + Intergenic
907746834 1:57222123-57222145 TTTCTAGCAGAAGAAACAAAGGG + Intronic
907806550 1:57826345-57826367 GCTGTAGAAGAGGAATAAACAGG + Intronic
908127698 1:61047622-61047644 ACTCTAAAAGAAAAAAAAAAAGG + Intronic
908138463 1:61157408-61157430 TCAATAGAGGAAGAAAAAAAAGG + Intronic
908449284 1:64235323-64235345 TCCCTAGAAGAAGAAGAGGCAGG - Intronic
909267882 1:73585135-73585157 TCACTAGAGGAATTAAAAACTGG + Intergenic
909315068 1:74205632-74205654 TCACTCAAAGAAGAACAAACTGG - Exonic
909352433 1:74670792-74670814 TCTCTACAAGAAGAAAAATATGG - Intronic
909824592 1:80111269-80111291 TCTCTGCAAGAAGAAAAATATGG + Intergenic
910073814 1:83252001-83252023 TCTCTGCAAGAAGAAAAATATGG + Intergenic
910501423 1:87895757-87895779 TCTCTTGAAAAAAAAAAAAAGGG - Intergenic
910536144 1:88300101-88300123 TCTAGTGAAGAAGAAAAAAATGG + Intergenic
910898761 1:92096550-92096572 TCTCTAAAAAAAAAAAAAAAAGG - Intronic
910943156 1:92558833-92558855 TCTCTAAAAAAAAAAAAAAAGGG + Intronic
911030249 1:93479704-93479726 TCTCTGCAAGAAGAAAAATATGG + Intronic
911249288 1:95557028-95557050 TCTCTGCAAGAAGAAAAATATGG - Intergenic
911487997 1:98526402-98526424 TCTCTGGAAGAAGAAAAATATGG + Intergenic
911591940 1:99758729-99758751 TCTCTGCAAGAAGAAAAATATGG - Intronic
911638605 1:100264121-100264143 TCTCTGCAAGAAGAAAAATATGG - Intergenic
911688190 1:100801339-100801361 TCTCTGCAAGAAGAAAAATATGG - Intergenic
911991817 1:104707684-104707706 TATCAACAAGAAGAATAAACCGG - Intergenic
912247889 1:107979746-107979768 TCTCTAGCAATAGAAAAAAAGGG - Intergenic
912263863 1:108134789-108134811 TCTCTAAAAAAAATAAAAACTGG + Exonic
912439036 1:109684532-109684554 TCTCTGCAAGAAGAAAAACATGG - Intronic
912441558 1:109702977-109702999 TCTCTGCAAGAAGAAAAATATGG - Intronic
912444937 1:109728493-109728515 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
913098059 1:115538356-115538378 TGTCTAGAAGAAGTAAAACCAGG + Intergenic
913494497 1:119415804-119415826 TCTCTAGAAGAGAAGAAAAGGGG - Intronic
914192311 1:145422034-145422056 TCTCAAGAAAAAAAAAAAAATGG + Intergenic
914820507 1:151098497-151098519 TCTCTAAAAAAAAAAAAAAAAGG + Intronic
914995853 1:152542827-152542849 ACTCTAGAAAAAGTAAAAAGGGG + Intronic
915097265 1:153472046-153472068 TCTCTGCAAGAAGAAAAATATGG - Intergenic
915135922 1:153731504-153731526 TCTTTGGCAGAAGAAAAACCAGG - Intronic
915390556 1:155539613-155539635 TCTCTACAAAAATAAAAAATTGG - Intronic
915403654 1:155642847-155642869 TCTCTGCAAGAAGAAAAATATGG + Intergenic
915426338 1:155830276-155830298 TCTCAAGAAAAAAAAAAAATTGG - Intronic
915663056 1:157419634-157419656 TTTCATGAAGAAGAAAAAAAGGG - Intergenic
916108221 1:161445962-161445984 TCTCTGCAAGAAGAAAAATATGG - Intergenic
916109807 1:161453342-161453364 TCTCTGCAAGAAGAAAAATATGG - Intergenic
916111394 1:161460753-161460775 TCTCTGCAAGAAGAAAAATATGG - Intergenic
916112980 1:161468133-161468155 TCTCTGCAAGAAGAAAAATATGG - Intergenic
916828850 1:168470449-168470471 TCTGCAGCAGAAGAGAAAACAGG + Intergenic
917078926 1:171236769-171236791 TCTCTGCAAGAAGAAAAATATGG + Intergenic
917177573 1:172253941-172253963 TCTCAAAAAGAAAAAAAAAATGG - Intronic
917310589 1:173674008-173674030 TATCTAGAAAAAGAAAAGAAAGG - Intergenic
917381098 1:174409578-174409600 TCTCTGCAAGAAGAAAAATATGG - Intronic
917594985 1:176520111-176520133 TGTCTAGAGTAAGACAAAACTGG - Intronic
917765173 1:178208246-178208268 TCTCTGCAAGAAGAAAAATATGG - Intronic
917801860 1:178579032-178579054 TCTCAAGAAAAAAAAAAAAAAGG - Intergenic
918000531 1:180490473-180490495 TCTCTACAAAAAAAAAAAAGAGG + Intronic
918004381 1:180527949-180527971 TCTCAAGAAAAAAAAAAAAGAGG - Intergenic
918065555 1:181098795-181098817 TCTCTAAAAGAAAAAAAATGTGG - Intergenic
918086047 1:181246348-181246370 TCTCTGCAAGAAGAAAAATATGG - Intergenic
918087041 1:181254572-181254594 TCTCTGCAAGAAGAAAAATATGG - Intergenic
918393206 1:184088059-184088081 CCTCTACAACAAGAGAAAACTGG - Intergenic
918461728 1:184783768-184783790 TCTCTGCAAGAAGAAAAATATGG - Intergenic
918642188 1:186855972-186855994 ATTCTTGAAGAAGAAAAAATTGG - Intronic
918710999 1:187729686-187729708 TCTCAAAAAGAAAAAAAAAATGG + Intergenic
918977792 1:191513125-191513147 TCTCTGCAAGAAGAAAAATATGG - Intergenic
919110096 1:193207615-193207637 TCTCTGCAAGAAGAAAAATATGG + Intronic
919280821 1:195486067-195486089 TCTCAAAAAGAAAAAAAAAAAGG + Intergenic
919518608 1:198558224-198558246 CCTGAAGAAGAAGAAAAAAGTGG - Intergenic
919624003 1:199893387-199893409 TCTCTGGAAAAAGAAAAGAATGG + Intergenic
919952627 1:202379225-202379247 TCTTTTCAAGAAGAGAAAACAGG - Intronic
920107725 1:203566202-203566224 TCTTTAGTAAAAGAGAAAACTGG - Intergenic
920360763 1:205414588-205414610 TCTCTACAAAATAAAAAAACTGG - Intronic
920405072 1:205703053-205703075 TCTCAAGAAAAAAAAAAAAATGG + Intergenic
920879532 1:209866952-209866974 TCTCTGCAAGAAGAAAAATATGG - Intergenic
920909028 1:210196707-210196729 TCTCTGCAAGAAGAAAAATATGG + Intergenic
921323878 1:213971445-213971467 TCTTTAGTGGAATAAAAAACTGG - Intergenic
921397264 1:214681823-214681845 TGTCTAAAAGAAAAAAAAAAAGG + Intergenic
921900426 1:220444449-220444471 TCTCTGCAAGAAGAAAAATATGG - Intergenic
922097158 1:222452212-222452234 TCCCAGGAAGAAGAGAAAACAGG + Intergenic
922598322 1:226830847-226830869 TCTCAAAAAGAAAAAAAAAAAGG + Intergenic
922710517 1:227826712-227826734 TCTCAAGAAAAAAAAAAAAGTGG + Intronic
923002774 1:230021326-230021348 TCTGAACAAGAAGAAAAGACAGG - Intergenic
923242632 1:232100278-232100300 TCTCTGCAAGAAGAAAAATATGG + Intergenic
923647489 1:235838990-235839012 TCTCTACAAAAAGAAAGAAAGGG - Intronic
923710456 1:236384827-236384849 TTTCTAGAAGAAATAAAAATAGG - Intronic
923883389 1:238128837-238128859 ACTCTAGCTGAAGAAAAAACTGG + Intergenic
924158671 1:241207806-241207828 CCACTAGAAAAAGAAAAGACTGG + Intronic
924238625 1:242020725-242020747 TCTCTAGAAAAAAAAAAAAAAGG + Intergenic
1063272685 10:4529319-4529341 TCTCTGAAGGAATAAAAAACAGG - Intergenic
1063446115 10:6118469-6118491 TCTCAAGAAGAAAAAAAAAAAGG - Intergenic
1063589601 10:7383335-7383357 TCTCTAAATAAACAAAAAACAGG + Intronic
1063599925 10:7471561-7471583 TATCTAGATGAAAAAAAAAATGG + Intergenic
1064146246 10:12828637-12828659 TCTCAAGAAAAAAAAAAAATTGG + Intronic
1064260659 10:13783390-13783412 TGTCTAAAAAAAGAAAAAAAAGG - Intronic
1064272717 10:13879812-13879834 TCTCAAGAAGAAGAAGAAGGAGG - Intronic
1064523009 10:16223208-16223230 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1064626196 10:17263932-17263954 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1064858669 10:19799998-19800020 TCTGTAGAACTAGAAAAAAATGG + Intergenic
1065142545 10:22733171-22733193 TCTCTAGAAGAATTAAAAACAGG - Intergenic
1065261116 10:23924409-23924431 TCTCTATAAGAAGAAAATGTAGG + Intronic
1065424838 10:25589735-25589757 TCTCTAGCAGATGAGAACACAGG + Intronic
1065475882 10:26137634-26137656 TCTCTGCAAGAAGAAAAATATGG - Intronic
1065499640 10:26366931-26366953 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1065584313 10:27202923-27202945 TGTATAGAAGAAGAAAAGAAAGG + Intronic
1065722259 10:28638112-28638134 TCTCTACAAAAATAAAAAATTGG + Intergenic
1066086427 10:31976271-31976293 TCTCTAAAAAAAAAAAAAAAAGG + Intergenic
1066122706 10:32305930-32305952 TCCTAAAAAGAAGAAAAAACAGG + Exonic
1066131302 10:32396920-32396942 TCTCTACAAAAAGAAAAAGAAGG + Intergenic
1066139745 10:32491593-32491615 TATCTAGTAAAAGACAAAACTGG - Intronic
1066257044 10:33690200-33690222 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1066636583 10:37508546-37508568 TCTCTAGAGAAAGAAAATTCTGG - Intergenic
1066658564 10:37718141-37718163 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1066664822 10:37772259-37772281 TCTCAAGAAAAAAAAAAAAAAGG + Intergenic
1066686147 10:37983344-37983366 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1067438915 10:46297230-46297252 TCTGTAGAAGAAGCAAAGAGTGG - Exonic
1067485393 10:46644636-46644658 TCTTTTAAAGAAGAGAAAACTGG + Intergenic
1067609365 10:47697028-47697050 TCTTTTAAAGAAGAGAAAACTGG - Intergenic
1067852690 10:49764342-49764364 TCTCTGGAAGGAAAAAAAAGAGG - Intergenic
1068020418 10:51575535-51575557 TCTCTATAAAAAGAAGAATCAGG - Intronic
1068031280 10:51708434-51708456 CCTCTAGGAAAAGAAAAAATGGG + Intronic
1068034356 10:51741423-51741445 TGGCTAGAAGAAGAAAACAGGGG - Intronic
1068296834 10:55081338-55081360 TCTCTATAAGAAGAGACAAGAGG - Intronic
1068508099 10:57928561-57928583 CCACTAGAAAAAAAAAAAACAGG + Intergenic
1068524860 10:58116852-58116874 TCTCTCGAAAAAAAAATAACTGG - Intergenic
1068534050 10:58220455-58220477 GCTTTAGAAGAAGAAAAAGGAGG + Intronic
1068568106 10:58597789-58597811 TCTCTGCAAGAAGAAAAATATGG + Intronic
1068736657 10:60420858-60420880 TATCCAAAAGAAGTAAAAACAGG + Intronic
1068743109 10:60497284-60497306 TCTTTAAAAAAAGAAAAAAATGG + Intronic
1068760692 10:60705786-60705808 CCTCTAGTAGAAAACAAAACTGG - Intronic
1068787476 10:60991752-60991774 CCTCTAGAAGGAGACAGAACAGG - Intronic
1069040202 10:63687891-63687913 TCTCAAGAACAAAAAAAAATTGG - Intergenic
1069094389 10:64241082-64241104 TCTCTAAAAGAAGAAAAATGTGG - Intergenic
1069149680 10:64943609-64943631 TAAATAAAAGAAGAAAAAACTGG + Intergenic
1069198398 10:65582873-65582895 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1069203868 10:65657787-65657809 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1069285103 10:66704285-66704307 ACTGTTGAAGAAGAAGAAACTGG - Intronic
1069320363 10:67163089-67163111 TTTCTAGAAGATAAAAAAAGAGG + Intronic
1069324360 10:67214207-67214229 TGTCCAAAAGAAGAAAAAAATGG - Intronic
1069389836 10:67922384-67922406 ACTCTATAAAAAGAAAAAAAAGG - Exonic
1069666046 10:70159633-70159655 TCTCAAAAAAAAGAAAAAAACGG + Intronic
1069844370 10:71360665-71360687 TTTCTAGAAGAGGAAATTACTGG - Intronic
1069922715 10:71826737-71826759 TCTCAAGAAAAAAAAAAAAATGG + Intronic
1069929158 10:71870566-71870588 TCTTAAGAAGAAAAAAAAAAAGG + Intergenic
1069975989 10:72213737-72213759 TCTCTAAAAAAAGAAAAAGAGGG + Intronic
1070389976 10:75961444-75961466 GCTCTAGAAGTAGAAATACCAGG + Intronic
1070463359 10:76691837-76691859 TCTCTGCAAGAAGAAAAATAGGG + Intergenic
1070911531 10:80123102-80123124 TGTTTAGAAGAGGAGAAAACTGG - Intergenic
1070970765 10:80565389-80565411 TCTTTAAAAGAAAAAAAAAAAGG - Intronic
1071006791 10:80892553-80892575 TCTCTACAAAAAAATAAAACCGG - Intergenic
1071052702 10:81471355-81471377 TCCCTAGCAGAGGAATAAACAGG + Intergenic
1071176566 10:82932997-82933019 TTTCTGGAAGAAGAATAAAGAGG - Intronic
1071263750 10:83945366-83945388 TCTCTGGCAAAAAAAAAAACTGG + Intergenic
1071599755 10:86953029-86953051 TCTCTGCAAGAAGAAAAATATGG + Intronic
1071624957 10:87158673-87158695 TCTTTTAAAGAAGAGAAAACTGG - Intronic
1071769296 10:88707124-88707146 TTTCTAGAAAAAGAAAACAAAGG - Intergenic
1072274485 10:93809600-93809622 GCTTTAGCAGAAGGAAAAACAGG + Intergenic
1072452952 10:95553689-95553711 TCTCTACAAAAAGAAAAATAAGG + Intronic
1072488908 10:95884351-95884373 TATCTACAACAAGAAAAAAATGG - Intronic
1072830397 10:98651772-98651794 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
1072992311 10:100208778-100208800 TGTCTAAAAAAAAAAAAAACTGG + Intronic
1073103932 10:101021639-101021661 TGTTTTGAAGAAGAAGAAACAGG - Intronic
1073133267 10:101204577-101204599 TCTCTAAAAAAAGAAAAAGACGG - Intergenic
1073274006 10:102292247-102292269 TCTCTAAAATAAGAAAATTCTGG + Intronic
1073344057 10:102768687-102768709 TCTCAAAAAAAAAAAAAAACTGG - Intronic
1073373022 10:103007621-103007643 TCTCTGCAAGAAGAAAAATATGG + Intronic
1073804241 10:107079222-107079244 TCTCAAAAAAAAAAAAAAACTGG + Intronic
1074114415 10:110444770-110444792 TCTCTAAAAAAAGAAAAAAAAGG + Intergenic
1074211779 10:111341755-111341777 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1074385185 10:113011003-113011025 TCTCAAAAAAAAGAAAAAAAAGG + Intronic
1074531760 10:114303307-114303329 TCTTTAAAATAAAAAAAAACTGG - Intronic
1075462010 10:122622820-122622842 TTTCTATTAGAATAAAAAACAGG + Intronic
1076023549 10:127093654-127093676 TCTTTATAAGAAAAAAAAAAAGG - Intronic
1076154536 10:128193491-128193513 CATTTAGAAGAAGAAAAGACAGG - Intergenic
1076332745 10:129682848-129682870 TCTCAAAAACAACAAAAAACTGG - Intronic
1076489811 10:130850991-130851013 TCTCAAGAAAAAAAAAAAAAAGG + Intergenic
1076650755 10:131985594-131985616 TCTCTAAAAAAAAAAAAAAAAGG - Intergenic
1077650688 11:3969315-3969337 TCTCTACAAAAAAAAAAAATTGG + Intronic
1078129372 11:8600552-8600574 TCTCTAAAAAAAAAAAAAAAAGG + Intergenic
1078229337 11:9425438-9425460 TCTCTATAAGGATAAAAAATAGG + Intronic
1078232040 11:9452335-9452357 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1078282442 11:9916597-9916619 TCTCAAAAAAAAGAAAAAAAAGG - Intronic
1078773491 11:14372906-14372928 TTTCTGGAAGAATAAGAAACTGG + Intergenic
1078780939 11:14438882-14438904 TAATTAGAAGAACAAAAAACAGG - Intergenic
1079414149 11:20217301-20217323 ACACTAGAAGAAGACAAAACTGG - Intergenic
1079975875 11:27090909-27090931 TCTCTGCAAGAAGAAAAACATGG + Intronic
1080155417 11:29105409-29105431 TCTCTGCAAGAAGAAAAATACGG - Intergenic
1080507982 11:32936694-32936716 GCTCTAGAACCAGAAAAACCTGG - Intronic
1080526990 11:33132380-33132402 TCTGTTGAAGAAAAAAAAAAAGG + Intronic
1081031477 11:38089783-38089805 TCTCTCCAAGAAGAAAAATGTGG - Intergenic
1081140551 11:39493730-39493752 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1081236160 11:40649413-40649435 TCTCTGCAAGAAGAAAAATATGG + Intronic
1081328445 11:41774676-41774698 TCTCTGTAAGAAGAAAAATATGG + Intergenic
1081392973 11:42551588-42551610 TCTTTAGAAGCAGAAAAACAGGG + Intergenic
1081552013 11:44122061-44122083 TCTCCAGAAAAAGAATAAACAGG - Intronic
1082048935 11:47754203-47754225 TCTCAAGAAAAAAAAAAAAAAGG + Intronic
1082143342 11:48635174-48635196 TCTCTACAAGAAGAGAAATATGG + Intergenic
1082282126 11:50281315-50281337 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1082292830 11:50400276-50400298 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1082570534 11:54732539-54732561 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1083087699 11:60167826-60167848 TCTCTCGAAAAAAAAAAAAAAGG + Intergenic
1083780670 11:64915804-64915826 TCTCTATAAAAATAAAAAAGGGG + Intronic
1083809443 11:65095547-65095569 TCTCTATAAAAAAAAAATACAGG - Intronic
1083854893 11:65388161-65388183 TCTCAAAAAAAAAAAAAAACAGG + Intronic
1084018123 11:66399034-66399056 TCTCAAAAAAAAGAAAAAAACGG - Intergenic
1084194258 11:67515222-67515244 TCTCTAAAAAAACAAAAAAGTGG - Intergenic
1084280268 11:68085386-68085408 TCTCTACAAGAAAAAAAAAAAGG - Intronic
1084583261 11:70037730-70037752 ACTCAACAAGCAGAAAAAACCGG - Intergenic
1084744339 11:71158975-71158997 TCTCTAGAAGAAAAAGTAAGAGG + Intronic
1085069938 11:73534858-73534880 TCTCCAGACAAAGAAATAACAGG + Intronic
1085333326 11:75670252-75670274 TCTCAAAAAGAAAAAAAAAGTGG + Intergenic
1085480241 11:76816033-76816055 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1085490452 11:76911670-76911692 TCTATAGAGGAAGAAGAAAAAGG - Intronic
1085626921 11:78080757-78080779 TCTCAAAAAGAAAAAAAAAAAGG + Intergenic
1085939165 11:81187376-81187398 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1086189556 11:84062667-84062689 GCTCTAGAAAAAGTAAAAACAGG - Intronic
1086322672 11:85666835-85666857 TATCTAGAAGAATAAATAAAAGG + Intronic
1086482701 11:87259837-87259859 TCCCTAGAGGAAGGAAAAAGTGG + Intronic
1087363440 11:97189486-97189508 TATCTAGAAAAAGAGAAAACTGG + Intergenic
1087443982 11:98223351-98223373 TCTCAAGAAAAAAAAAAAATTGG - Intergenic
1087514382 11:99139373-99139395 TCTATAAAAGAGGAAAAAGCAGG + Intronic
1087680256 11:101211965-101211987 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1087681329 11:101220999-101221021 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1088027652 11:105205886-105205908 TCTATAGAAGTAGAAAAGGCTGG - Intergenic
1088161313 11:106874758-106874780 CCACTAAAAGAAAAAAAAACTGG + Intronic
1088183364 11:107136838-107136860 TCTCAAAAAGAAAAAAAAAAAGG + Intergenic
1088210504 11:107450095-107450117 TCTCAAGAAAAAAAAAAAAAAGG + Intronic
1089093028 11:115894072-115894094 TCTCTAGAAGAGGGAATGACAGG + Intergenic
1089295216 11:117463363-117463385 TCTCTAAAAAAAAAAAAAAAAGG - Intronic
1089463477 11:118667180-118667202 TGTCTAAAAAAAGAAAAAATAGG - Intronic
1089534436 11:119152071-119152093 TCTCTTGCAGGAGAAGAAACTGG - Intronic
1089980669 11:122769488-122769510 TCTCTAGTAGAAGAAAAATGAGG - Intronic
1090157487 11:124456720-124456742 TCTTCAAAACAAGAAAAAACAGG - Intergenic
1090223925 11:125057376-125057398 TATCTATAATAACAAAAAACTGG - Intergenic
1090654084 11:128829275-128829297 TCTCTACAAAAAAAAAAAAATGG - Intergenic
1091144451 11:133265451-133265473 TCTCTAGAAGGACAGAAAACAGG - Intronic
1091192315 11:133706275-133706297 TCTTCAGAAGAAGAGAAAACCGG + Intergenic
1091244108 11:134077362-134077384 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
1091274499 11:134341534-134341556 TCTTTAGAAAAAGAAAAATGTGG + Intronic
1091410440 12:235732-235754 TCTCTGCAAGAAGAAAAATATGG - Intronic
1091729610 12:2870658-2870680 TCTCAAAAAGAAAAAAAAAGAGG + Intronic
1091884488 12:4006068-4006090 TCTCTCAAAGAAAACAAAACAGG - Intergenic
1092289663 12:7151753-7151775 TCTTTTAAAGAAGAAAAATCAGG + Intronic
1092530124 12:9336975-9336997 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1092770747 12:11894354-11894376 TCTCTATCAGAAGAAAGCACTGG + Exonic
1092900365 12:13053967-13053989 TCTCTGCAAGAAGAAAAATATGG + Intronic
1093293255 12:17355478-17355500 TGTGTAGAAGAAGAAAACACCGG - Intergenic
1093508176 12:19893822-19893844 TGTCTAAAAGAGGCAAAAACAGG - Intergenic
1093723750 12:22478842-22478864 TCTCAAAAAAAAGAAAAAAAGGG + Intronic
1093729888 12:22555223-22555245 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1093735191 12:22613153-22613175 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1093828166 12:23721011-23721033 TCTACAAAAGAAGAAAAAGCTGG + Intronic
1093955215 12:25209175-25209197 TTTCTATAAAAAGAAAAAAATGG - Intronic
1094277430 12:28693879-28693901 TCTGGAGAAGAATGAAAAACGGG - Intergenic
1094578231 12:31708160-31708182 TCTCTGCAAGAAGAAAAATATGG - Intronic
1094729004 12:33153258-33153280 TCTCTACAAGAAGAAAAATATGG - Intergenic
1095252891 12:39999316-39999338 TCTCTGCAAGAAGAAAAATATGG - Intronic
1095601614 12:44019543-44019565 TATCCAGAAGAAGAAGAAAGAGG - Intronic
1095692096 12:45101355-45101377 TTTCTACAAGAAGAAAATAATGG - Intergenic
1096352616 12:50912718-50912740 TCTCTACAAGAAGAAAAATATGG + Intergenic
1096723988 12:53546370-53546392 TCTCAAAAAAAACAAAAAACAGG + Intronic
1096761091 12:53842577-53842599 TCTCAAGAAAAAAAAAAAAAAGG + Intergenic
1096959125 12:55560407-55560429 TAACTAGAATAAGAAAAAAGAGG + Intergenic
1097367957 12:58741123-58741145 TTTCTAAAAGAAAAAAAATCTGG + Intronic
1097523207 12:60695415-60695437 TCTCAAAAAGAAGATAAAAGCGG - Intergenic
1097730698 12:63124894-63124916 TCTCTAGGAAAACAAAAATCTGG + Intergenic
1097818928 12:64107479-64107501 TATCTAGAAGTAGAAACTACAGG + Intronic
1098070839 12:66673098-66673120 TTTCTAGAAGAGAAAAAAAATGG + Intronic
1098129873 12:67338963-67338985 GCTTTAGAAGAAGAAACAACGGG - Intergenic
1098352420 12:69577704-69577726 TTTTTAGAAGAAGATGAAACTGG - Exonic
1098497157 12:71149905-71149927 TCTCTGCAAGAAGAAAAATATGG - Intronic
1098620104 12:72585600-72585622 TCTTTAGTAGAAGCAAAACCAGG - Intronic
1098741189 12:74175457-74175479 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1098993297 12:77090148-77090170 ACTCCAGAAGTAGAAAGAACTGG + Intergenic
1099239145 12:80117614-80117636 TGTTTTGAAGAAGAAAAAATAGG - Intergenic
1099551894 12:84055960-84055982 TCTCAAAAAGAAAAAAAAAAGGG + Intergenic
1099648777 12:85396661-85396683 TCTCAAAAAGAAAAAAAAATTGG + Intergenic
1100087550 12:90929982-90930004 TCTCTGCAAGAAGAAAAATATGG + Intronic
1100108115 12:91203034-91203056 TTTCTAGAATTAGAAAAAAGGGG + Intergenic
1100394092 12:94169702-94169724 GCTTGAAAAGAAGAAAAAACAGG + Intronic
1100418002 12:94398705-94398727 TCTCTGCAAGAAGAAAAATATGG - Intronic
1100454623 12:94740472-94740494 TCTAAAGAAAATGAAAAAACGGG + Intergenic
1100934204 12:99644844-99644866 CCTCTGGAAGCTGAAAAAACAGG - Intronic
1101024654 12:100588844-100588866 TCTCTGCAAGAAGAAAAATATGG + Intronic
1101220634 12:102635540-102635562 TCTCTACAAGAAGATACAACTGG + Intergenic
1101321930 12:103680310-103680332 TCTTAAGAAGAAAAAAAAACTGG + Intronic
1101410888 12:104467322-104467344 TGTCTAGATGAACAAAAAATGGG + Intronic
1101480874 12:105095687-105095709 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1101644764 12:106620939-106620961 TCTCTGCAAGAAGAAAAATATGG + Intronic
1102458295 12:113084549-113084571 TCTCTACAAAAATAAAAAATTGG - Intronic
1102470247 12:113155667-113155689 TCTCAAAAAGAAAAAAAAAGTGG + Intronic
1102678180 12:114672561-114672583 TCCTTATAGGAAGAAAAAACAGG + Intronic
1102706543 12:114885676-114885698 TCTCTAAAAAAAGAAAAACTTGG - Intergenic
1102862351 12:116347187-116347209 CCTCTAGAATAAGAAAAACTTGG + Intergenic
1103093427 12:118113983-118114005 TCTCTAAAAAAAAAAAAAACTGG - Intronic
1104248367 12:127064690-127064712 TCTCAAGAAAAAAAAAAAAGGGG + Intergenic
1104266654 12:127239771-127239793 TCTCTGGAAGAAGAGAAAGGAGG + Intergenic
1104277940 12:127347115-127347137 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1104613928 12:130253238-130253260 TGTTTAGAAGAAAATAAAACAGG + Intergenic
1105228926 13:18470316-18470338 AATATAGAAAAAGAAAAAACTGG + Intergenic
1105244383 13:18635639-18635661 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1105269082 13:18854081-18854103 TCTGTAGAAGAAGGAAGAACAGG - Intergenic
1105301753 13:19141559-19141581 TCTCAAAAACAAGAAAAAAAGGG + Intergenic
1105592756 13:21809966-21809988 TCTCAAAAAAAAGAAAAAAAAGG - Intergenic
1105734020 13:23248690-23248712 TCTCAAAAAGAAAAAAAAAAAGG + Intronic
1105789667 13:23785656-23785678 CCTCTAAAAAAAGAAAAAAAGGG + Intronic
1105807313 13:23961800-23961822 TCACTCAAAGAAGAAAAAAAGGG - Intergenic
1106263771 13:28091765-28091787 TCTCTATAAAAATAAAAAATAGG + Intronic
1106583971 13:31041208-31041230 TATATAGAAGGAGAAAATACAGG + Intergenic
1106632591 13:31491671-31491693 TCTCAAAAAGAAAAAGAAACTGG + Intergenic
1106645329 13:31628479-31628501 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1106870725 13:34016473-34016495 ACTCTAGAAAAAGGCAAAACTGG - Intergenic
1106877914 13:34095666-34095688 TCTCGAGAAAAAGAAAAAATAGG + Intergenic
1107153075 13:37134267-37134289 ACTCTGGAAGAAGAAAAAAAAGG + Intergenic
1107239250 13:38212195-38212217 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1107274459 13:38662396-38662418 TCTCTAGAAGAAGAAAACAGGGG + Intergenic
1107340151 13:39396792-39396814 TCTCAAAAAGAAAAAAAGACAGG + Intronic
1107722969 13:43268161-43268183 TATCTAAAAGAAAAAAAATCGGG + Intronic
1107767271 13:43750168-43750190 TCCCAGGAGGAAGAAAAAACAGG + Intronic
1108791503 13:53973711-53973733 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1108960553 13:56222281-56222303 TCTCTGCAAGAAGAAAAATACGG + Intergenic
1109091097 13:58047085-58047107 TCTCCAGAGCAAGAAACAACAGG - Intergenic
1109489594 13:63078809-63078831 TCTCTAGAAAAACATAAAAATGG - Intergenic
1109647155 13:65273802-65273824 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1109926350 13:69145387-69145409 TCTTTAGAGGATGAAAAGACAGG + Intergenic
1109963341 13:69660220-69660242 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1110080150 13:71299190-71299212 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1110408966 13:75183592-75183614 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1110529082 13:76575667-76575689 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1110579949 13:77110136-77110158 TCTCTGTAAGAAGAAAAATGTGG - Intronic
1110953645 13:81524948-81524970 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1111011262 13:82317818-82317840 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1111286398 13:86098875-86098897 TCTCTTTAAGAAAAAAAAAAAGG + Intergenic
1111376851 13:87391491-87391513 TGTCCACAAGAAGAAAAAATAGG + Intergenic
1111455659 13:88480534-88480556 TCTATAAAAGAATAAAAAAATGG - Intergenic
1111593218 13:90377089-90377111 TCTCTAGCAGACTAAAATACAGG - Intergenic
1112053652 13:95670240-95670262 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1112118428 13:96383441-96383463 TCTCAAAAAGAAAAAAAAAGTGG + Intronic
1112252369 13:97793848-97793870 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1112766177 13:102746654-102746676 ACTTTAGAACAAGATAAAACAGG + Exonic
1112871848 13:103981581-103981603 TATGTAGCAGAAGAAAAAATAGG - Intergenic
1113214029 13:108017342-108017364 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1113251609 13:108458905-108458927 TTTCAATAACAAGAAAAAACTGG + Intergenic
1113536626 13:111071803-111071825 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1113827409 13:113267533-113267555 TCTCAAAAAAAAAAAAAAACTGG + Intergenic
1113870951 13:113559811-113559833 TCTCAAAAAGAAAAAAAAAAGGG + Intergenic
1114301363 14:21381785-21381807 TCTCTACAAAAAAAAAAAAAAGG - Intronic
1114601298 14:23957556-23957578 TCTCTGGAAAAAAAAAAAAAAGG - Intronic
1114750558 14:25200080-25200102 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1114768353 14:25400336-25400358 TGGCTAGAAGCAGAAGAAACTGG - Intergenic
1114836819 14:26212393-26212415 ACTTTAGAAGAAGAAGAAAATGG - Intergenic
1115026599 14:28754589-28754611 TTTCCAGATTAAGAAAAAACTGG + Intergenic
1115359540 14:32485914-32485936 ACTCTAGAAGAAGAAAACCTAGG - Intronic
1115386578 14:32804897-32804919 TCTCTGCAAGAAGAAAAATATGG + Intronic
1115467681 14:33733764-33733786 TCTCTAAAACAAAAAAAAAGAGG + Intronic
1115526082 14:34281961-34281983 TCTCTGCAAGAAGAAAAATACGG + Intronic
1115560752 14:34580659-34580681 TCTCTAAAAAAAAAAAAAAATGG - Intronic
1115564214 14:34611473-34611495 TCTCAAAAAGAAAAAAAAAAAGG + Intronic
1115600463 14:34950890-34950912 TCTCAAAAAAAAAAAAAAACCGG - Intergenic
1115655353 14:35438511-35438533 TCTCAAAAAGAAAAAAAAAAAGG + Intergenic
1115671003 14:35611562-35611584 TCTCTACAAAAAAAAAAAATTGG + Intronic
1115763853 14:36602571-36602593 TCTCGAGAAAAAAAAAAAAATGG + Intergenic
1115886775 14:37981109-37981131 TCTCTGCAAGAAGAAAAATATGG - Intronic
1116134350 14:40901413-40901435 AATCTAGAAGAAGTAAAAAATGG - Intergenic
1116161346 14:41269836-41269858 GTCCTAGAAGAAGTAAAAACTGG - Intergenic
1116200771 14:41792622-41792644 TCTCTGCAAGAAGAAAAATATGG + Intronic
1116233092 14:42242833-42242855 TCTATAGAAACAGAAAAAAGAGG + Intergenic
1116554746 14:46288626-46288648 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1116755771 14:48946225-48946247 TGTCAAGAAGAAAAAAAAAGAGG + Intergenic
1116904963 14:50395661-50395683 TGTCTCGAAAAAGAAAAAAAAGG + Intronic
1117098638 14:52322813-52322835 TCTCTGCAAGAAGAAAAATACGG + Intronic
1117201634 14:53395647-53395669 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1117346207 14:54835367-54835389 TATTTATAATAAGAAAAAACTGG + Intergenic
1117357915 14:54943836-54943858 TCTCTATAAAAAAAAAAAAGAGG + Intronic
1117515629 14:56498563-56498585 TTTCTAGAAAAAGAACAAAGGGG - Intronic
1117661370 14:58009083-58009105 GCTATAGAAGAAGAAAAGAATGG - Intronic
1117767120 14:59094876-59094898 TTTGTAGAAGAAGATAAAAGGGG + Intergenic
1117834619 14:59790519-59790541 CCCCTAGAAGAGGAAAAATCAGG - Intronic
1118091961 14:62491541-62491563 TTTCTACAAAAAGAAAACACTGG + Intergenic
1118216377 14:63812295-63812317 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1118237354 14:64020189-64020211 TCTCTAAAAGAAGAAAAAAACGG + Intronic
1118713498 14:68541694-68541716 TTTCTTAAAGAAGAAAAAGCTGG + Intronic
1119101856 14:71887408-71887430 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1119288900 14:73478938-73478960 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
1119299785 14:73562540-73562562 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1119514821 14:75239820-75239842 TCTCTACAAAAAAAAAAAAGTGG - Intronic
1119600386 14:75972018-75972040 TCTCAAAAAGTAGGAAAAACGGG - Intronic
1119681042 14:76592396-76592418 TGTCTTGAAGAAGAAAAGAAAGG - Intergenic
1119869245 14:78001262-78001284 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1120109680 14:80539716-80539738 TCTCTGCAAGAAGAAAAATATGG - Intronic
1120130335 14:80799530-80799552 TCTCTGCAAGAAGAAAAATATGG - Intronic
1120201046 14:81538531-81538553 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1120397076 14:83981702-83981724 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1121051732 14:90823540-90823562 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1121064888 14:90953556-90953578 TCTCTGCAAGAAGAAAAATATGG - Intronic
1121568664 14:94930145-94930167 CTTCTAGAAGAATAAAAAATGGG - Intergenic
1121822051 14:96978418-96978440 TGTCCAGAAAAAGAAAAAAAAGG + Intergenic
1121858151 14:97289670-97289692 TCTCTAAAAAAAAAAAAAAAGGG - Intergenic
1122230174 14:100303005-100303027 GCTCTGGAAGAAGAAGGAACAGG - Intronic
1122231550 14:100308592-100308614 TCTCTAAAAAAAAAAAAAATCGG + Intergenic
1122614090 14:103004865-103004887 TCTCAAAAAGAAAAAAAAAATGG + Intronic
1122645855 14:103193310-103193332 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1122777473 14:104127559-104127581 TCTCAAGAAGAAAAAAAAAAGGG - Intergenic
1122844284 14:104482427-104482449 TCTCTGCAAGAAGAAAAATATGG + Intronic
1123137489 14:106042903-106042925 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1202830225 14_GL000009v2_random:19907-19929 TCTGTAGAAGAAGGAAGAACAGG + Intergenic
1202889812 14_KI270722v1_random:145367-145389 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1123763406 15:23450470-23450492 TCTCAAAAAAAAGAAAAGACCGG - Intergenic
1123797539 15:23787376-23787398 GCTCTAGAAAAAAAAAAAAGTGG - Intergenic
1123824988 15:24072222-24072244 TCTCTAGAAGCAGGAAATGCAGG + Intergenic
1124225752 15:27893465-27893487 TCTCTGCAAGAAGAAAAATATGG - Intronic
1124430280 15:29601432-29601454 ACTCTAGAAAAAAAAAAAAAAGG - Intergenic
1124480058 15:30070688-30070710 TCTCAAAAAAAAAAAAAAACTGG - Intergenic
1124924855 15:34061116-34061138 TCTCTAGAAGGAAAAATAAATGG + Intronic
1125005080 15:34807710-34807732 TCTCTGCAAGAAGAAAAATGTGG + Intergenic
1125296209 15:38206211-38206233 TCTTTTGAAGATGAAAGAACAGG + Intergenic
1125529450 15:40402905-40402927 TCTTTAAAAAAAGAAAAAAGAGG + Intergenic
1125825616 15:42673867-42673889 CCTCTAGAATAAAAAAGAACTGG - Intronic
1125874044 15:43128477-43128499 TCTCTGCAAGAAGAAAAATATGG - Intronic
1126007441 15:44271681-44271703 TCTGAAGAAGAAGAGAAAATTGG + Intergenic
1126021999 15:44410726-44410748 TCTCTACAAAAAAAAAAAAAAGG + Intronic
1126059920 15:44770770-44770792 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1126120374 15:45246213-45246235 TTTCTACAAAAAGAAAAAAAAGG - Intergenic
1126228269 15:46296296-46296318 TCTGTGGAAGAAGAAACAAGTGG + Intergenic
1126602673 15:50444504-50444526 TCTCAAGAAGAGAAAAAAAAAGG - Intronic
1126720954 15:51579101-51579123 TCTCAAGAAAAGGAAAAAAATGG + Intronic
1126744770 15:51814881-51814903 GCTGAAGAGGAAGAAAAAACTGG - Exonic
1126855714 15:52837567-52837589 TCTCTAGAGAAAGAACAAACAGG - Intergenic
1127169383 15:56284158-56284180 TCTTTAGAAAAAGAAAAAAAAGG - Intronic
1127396111 15:58545238-58545260 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
1128015123 15:64338088-64338110 TATCTAAAAGAATCAAAAACAGG - Intronic
1128407120 15:67353668-67353690 TCTTTAAAAGAACATAAAACAGG + Intronic
1128678867 15:69631891-69631913 GTACTAGAAGAAGAGAAAACAGG + Intergenic
1129024087 15:72552774-72552796 TCTCAAAAAAAAAAAAAAACAGG - Intronic
1129310394 15:74704209-74704231 TCTCTACAAAAACAAAAAATTGG + Intergenic
1129347551 15:74933000-74933022 TTTCTACAACAAGAAAAAAATGG + Intronic
1129915639 15:79267541-79267563 TCTCTAAAAAAAGAAAAAAAGGG + Intergenic
1131135479 15:89931506-89931528 TCTCTTTAAGAAAAAAAAAGAGG + Intergenic
1131171712 15:90183933-90183955 CCTCCAGAAAAAGAAAAAAGTGG - Intronic
1131586574 15:93702083-93702105 TTTCTAGAAGAAAATATAACTGG - Intergenic
1132021394 15:98365727-98365749 TGTCTAAAAGAAAAAAAAAAAGG - Intergenic
1132515877 16:365748-365770 TCTCAAAAAGAAAAAAAAAAAGG - Intergenic
1132563089 16:607498-607520 TCTCAAAAAAAAAAAAAAACGGG + Intronic
1132859888 16:2065110-2065132 TCTCAAAAAGAAAAAAAAAAAGG + Intronic
1133065756 16:3205988-3206010 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1133107721 16:3524298-3524320 TCTCAAAAAGAAAAAAAAAAAGG + Intronic
1133361661 16:5178747-5178769 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1133702207 16:8319255-8319277 TTCCTAGAGGAAGAAAAATCTGG + Intergenic
1133964767 16:10522616-10522638 TCTCAAAAAAAAAAAAAAACAGG + Intergenic
1134061879 16:11204227-11204249 TCTCAAAAAAAAAAAAAAACAGG + Intergenic
1134303245 16:13009865-13009887 TTTCTATAAAAAGGAAAAACAGG - Intronic
1134664933 16:16011967-16011989 TCTCTACAAAAATAACAAACTGG - Intronic
1135009074 16:18856864-18856886 TCTCAAAAAAAAAAAAAAACAGG + Intronic
1135096190 16:19566751-19566773 TCTCAAAAAAAAGAAAAAAAAGG - Intronic
1135175507 16:20224520-20224542 TGTCTATAAGAAGAAGAAAGTGG + Intergenic
1135588436 16:23688906-23688928 TCTCTGGAAAAAAAAAAAGCTGG - Intronic
1135593461 16:23722659-23722681 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1135649418 16:24192959-24192981 TCTTTAAAAAAAGAAAAAAAAGG - Intronic
1135769480 16:25206348-25206370 TCTCAAAAAAAAAAAAAAACAGG - Intergenic
1136177105 16:28524690-28524712 TCTCAAAAAAAAAAAAAAACAGG + Intergenic
1136281655 16:29216417-29216439 TTTCTAAAAGAAAAAAAAAAAGG - Intergenic
1136361522 16:29783383-29783405 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1136463486 16:30426473-30426495 TCTCAAAAAAAAAAAAAAACCGG - Intronic
1136486327 16:30574242-30574264 TCTCAAAAAGAAAAAAAAATTGG + Intronic
1136733065 16:32436602-32436624 TCACTACAAAAAGAAAAAAAAGG + Intergenic
1137498121 16:48986691-48986713 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1137654107 16:50145569-50145591 TCTCTAAAAAAAAAAAAACCAGG - Intergenic
1138534877 16:57654419-57654441 TGTCTCGAAAAAAAAAAAACGGG - Intronic
1138616594 16:58172498-58172520 TCTCTTTGAAAAGAAAAAACAGG - Intronic
1138764503 16:59585665-59585687 TGGCTAGAAAAAGAAAATACAGG + Intergenic
1139014104 16:62669165-62669187 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1139277888 16:65744672-65744694 TCTCTAAGATAAGAAAACACAGG - Intergenic
1139382306 16:66540482-66540504 TTTCTAGCAGAAGTAAAAACAGG + Intronic
1139451421 16:67030272-67030294 TCTCTATTAGAATAAATAACTGG - Intronic
1139499300 16:67348459-67348481 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
1140095127 16:71868743-71868765 TCTCTCAAAAAAAAAAAAACTGG - Intronic
1140394940 16:74618324-74618346 TGTCCAATAGAAGAAAAAACGGG - Intergenic
1140819439 16:78649283-78649305 TCTCTAAAAAAATTAAAAACAGG - Intronic
1141306758 16:82871867-82871889 TAGCTAGAAGAATAAAAGACTGG - Intronic
1141315396 16:82957858-82957880 TCTCCAAAAGAAGCAATAACTGG - Intronic
1141380412 16:83571400-83571422 TCTTTAAAAGAAAAAAAAACTGG + Intronic
1141672672 16:85500926-85500948 TCTCTAGCAGAAGAGGAAAAGGG - Intergenic
1142217413 16:88836650-88836672 TCTCAAGAAAAAAAAAAAAAAGG + Intronic
1203020016 16_KI270728v1_random:393001-393023 TCACTACAAAAAGAAAAAAAAGG - Intergenic
1203038351 16_KI270728v1_random:666159-666181 TCACTACAAAAAGAAAAAAAAGG - Intergenic
1142840342 17:2623627-2623649 TCTTTAAAAAAAAAAAAAACGGG - Intronic
1142841562 17:2635531-2635553 TCTCTACAAGTAAAAAAAATTGG - Intronic
1142894938 17:2968635-2968657 TCTGTAGAAAAAGAAAACAAAGG + Intronic
1142936111 17:3333030-3333052 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1143131137 17:4677913-4677935 TCTCAAAAAGAAAAAAAAAAAGG + Intronic
1143133868 17:4699376-4699398 TCTCAAAAAGAAAAAAAAAATGG + Intronic
1143233652 17:5379246-5379268 TCTGAAGAAAAAGAAAAGACTGG - Intronic
1143857804 17:9865226-9865248 TCTTTAGAAGAAGAATTGACAGG - Intronic
1145029899 17:19496372-19496394 TCTCTACAAAAGGAAAAAAAAGG + Intronic
1145917923 17:28587244-28587266 TCTCTAAAAAAAAAAAAAAAAGG + Intronic
1146135949 17:30321161-30321183 TCTCTAAAAAAAAAAAAAAAGGG - Intronic
1146321196 17:31847878-31847900 TCTCAAGAAGAAAAAAAAAAAGG + Intergenic
1146406940 17:32546908-32546930 TCTCTAAAAAAAAAAAAAAAAGG - Intronic
1146719408 17:35113269-35113291 TCTCAAAAAGAAAAAAAAAATGG - Intronic
1146753273 17:35401826-35401848 TCTCTACAAAAAAAAAAAAAAGG - Intergenic
1147268613 17:39250545-39250567 TCTCCAAAAGAAAAAAAAAAAGG + Intergenic
1147526573 17:41230178-41230200 GCTCTAGAAGAAGGAAGAAGAGG + Intronic
1147682582 17:42260916-42260938 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
1148410252 17:47460347-47460369 TCTCAAAAAGAAAAAAAAAGTGG + Intergenic
1149113851 17:53067351-53067373 TCTCTTGAAAAAAAAAAAAAAGG - Intergenic
1149174966 17:53858785-53858807 TCTCTGCAAGAAGAAAAATACGG - Intergenic
1149182495 17:53956103-53956125 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1149196393 17:54126874-54126896 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1149220192 17:54408167-54408189 TCTCGAAAAGAAAAAAAAAAAGG + Intergenic
1149247054 17:54722013-54722035 TCTCAAGAAGAAGAAAATGATGG + Intergenic
1149857245 17:60093430-60093452 TCTCTGTAAGAAGAAAAATATGG + Intergenic
1149870832 17:60180025-60180047 TCTCAAGAAAAAAAAAAAACAGG - Intronic
1150032424 17:61753601-61753623 TCTCTAAAAAAAAAAAAAAATGG - Intronic
1150525598 17:65919161-65919183 TCTCATGAAGAAGACAAAATAGG - Intronic
1150605884 17:66690447-66690469 TCTCTGGAAGAAGGAAGATCCGG - Intronic
1150691127 17:67367873-67367895 TCTCTACAAAAATAAAAAAAAGG - Intergenic
1150975275 17:70079042-70079064 TCTAGAGAAGCAGAAGAAACAGG + Intronic
1151246560 17:72799453-72799475 TCTCTGCAAGAAGAAAAATATGG - Intronic
1151279016 17:73057933-73057955 TCTCCAAAAAAAGAAAACACAGG + Intronic
1151281298 17:73076590-73076612 TGTCTTGAAAAAGACAAAACTGG - Intronic
1151293789 17:73168756-73168778 ACTCTAGAGGCAGAACAAACCGG - Intronic
1151524654 17:74656309-74656331 TCTCTACAAAAAGAAAGAAAAGG + Intergenic
1152058097 17:78048114-78048136 TCACTAAAAGAAGAAAAAGAAGG - Intronic
1152181879 17:78827345-78827367 TCTCTAAAAGAGGAAGAAACAGG + Exonic
1152490429 17:80628641-80628663 TCTCTAAAAGAAAAAAAAAAGGG - Intronic
1152725988 17:81946350-81946372 TCTCGAAAAGAAGAAAAGGCCGG + Intronic
1152995723 18:404897-404919 TCTCTGCAAGAAGAAAAATAAGG - Intronic
1153036135 18:764221-764243 TCTCAAAAAAAATAAAAAACTGG - Intronic
1153074250 18:1144461-1144483 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1153237616 18:3003855-3003877 TCTCTGCAAGAAGAAAAATATGG - Intronic
1153482286 18:5558842-5558864 TCTCTAGACGAGGACATAACAGG + Intronic
1153630370 18:7063505-7063527 TATCCAGAAGAAGAGAAAGCAGG + Intronic
1153886435 18:9471859-9471881 TAAATAGAAAAAGAAAAAACAGG - Intergenic
1153889863 18:9502903-9502925 TCTCTGCAAGAAGAAAAATATGG - Intronic
1154418946 18:14205901-14205923 TCTGTAGAAAAAGGAAGAACAGG + Intergenic
1154444555 18:14424264-14424286 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1154524526 18:15269809-15269831 AATATAGAAAAAGAAAAAACTGG - Intergenic
1155373979 18:25136136-25136158 TATCCAGAAGAAGAAAACATTGG - Intronic
1155597147 18:27501640-27501662 CCTTTATAAGAAGAAAAATCAGG + Intergenic
1155655201 18:28184459-28184481 TCTCTAAAATAAAAAAAAATTGG + Intergenic
1155714929 18:28930133-28930155 TTTCTAAAAGAAGGAAAAAAAGG - Intergenic
1155796725 18:30047706-30047728 TTTCTAAAAGAAGACAAAAAAGG + Intergenic
1155988690 18:32257019-32257041 TCTCAAGAAAAAAAAAAAAAAGG + Intronic
1156205684 18:34883311-34883333 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
1156225934 18:35107995-35108017 TTTTTAGAAGAAGACAAAAAAGG - Intronic
1156465946 18:37347907-37347929 TCTCTCGAAGAAGAAAATAAAGG - Intronic
1156902886 18:42321831-42321853 TCTCTAAAAAAAAAAAAAAAAGG + Intergenic
1156909748 18:42397081-42397103 TCTCAAGAAAAACAAAATACTGG + Intergenic
1156991615 18:43415433-43415455 TATCTTGAAGAAGGAAAAGCTGG - Intergenic
1157706218 18:49809121-49809143 TCTCTGCAAGAAGAAAAATATGG + Intronic
1158595306 18:58810632-58810654 TCTCTAGAAACAAATAAAACAGG + Intergenic
1158764168 18:60428454-60428476 TCTCCATAAGAAGGAAAAATTGG + Intergenic
1159347692 18:67228107-67228129 TCTCTGCAAGAAGAAAAATACGG - Intergenic
1159538836 18:69749452-69749474 TCTCTTGATGATGAAAAAAAAGG + Intronic
1159596934 18:70391556-70391578 TCTCTACTAGAAAAAAAAAATGG - Intergenic
1159815684 18:73071638-73071660 TCTCTGAAAGAAGAAAAATATGG - Intergenic
1160620214 18:80165334-80165356 TCTCTGCAAGAAGAAAAATATGG + Intronic
1160737240 19:668957-668979 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1160821300 19:1059563-1059585 TCTCTAAAAAAAGATAAAATAGG - Intronic
1161019492 19:2001489-2001511 TCTCAAAAAGAAAAGAAAACAGG + Intronic
1161224593 19:3137272-3137294 TATCTAGGAGAAAACAAAACAGG + Intronic
1161289355 19:3484802-3484824 TCTCAAGAAAAAAAAAAAATTGG + Intergenic
1161295135 19:3515762-3515784 TCTCTAAAAAAAAAAAAAAAAGG + Intronic
1161452806 19:4355856-4355878 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
1161638232 19:5402662-5402684 TCTCCAGAAGGAGAAAGAGCTGG + Intergenic
1161707852 19:5830434-5830456 TCTCAAGAAAAAAAAAAAAAGGG - Intergenic
1161833403 19:6627265-6627287 TCTCAAGAAAAAAAAAAAAAAGG - Intergenic
1162038342 19:7954446-7954468 TCTCTCAAAGAAAAAAAAAAAGG - Intergenic
1162405465 19:10470436-10470458 TCTCGAAAAGAAAAAAAAAAAGG + Intergenic
1162684200 19:12368045-12368067 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1162748110 19:12810828-12810850 TCTCTATAAAAACAAAAAATAGG - Intronic
1162761852 19:12893186-12893208 TCTCTAAAAAAAGAAACAAAGGG - Intronic
1162976145 19:14207808-14207830 TCTCTAAAAGAGTAAAAACCCGG + Intergenic
1163007258 19:14404863-14404885 TCTCAAAAAAAAAAAAAAACGGG - Intronic
1163096333 19:15060057-15060079 TCTCAAAAAGAAAAAAAAAAAGG + Intergenic
1163141642 19:15353178-15353200 TTTTTATAAGAAGAAAAAAAAGG + Intergenic
1163143402 19:15364784-15364806 TCTCGAGAAAAAGAAAAGTCTGG - Intronic
1163143693 19:15366907-15366929 TCTCAAAAAGAAAAAGAAACGGG - Intronic
1163755345 19:19103393-19103415 TCCTTATAAGAAGAGAAAACAGG - Intronic
1163941676 19:20500850-20500872 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1163942665 19:20509347-20509369 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1164277871 19:23737691-23737713 TCTCAAGAAAAAAAAAAAAAAGG - Intergenic
1164288724 19:23847912-23847934 TCTCTGCAAGAAGAAAAATGTGG + Intergenic
1164405768 19:27944653-27944675 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1164489800 19:28698002-28698024 AATCTATAAGAAAAAAAAACAGG + Intergenic
1164665816 19:30035740-30035762 TCAGTAGAAGAAAAAAAAAAAGG - Intergenic
1164726797 19:30470986-30471008 TCTCTAAAAAAAAAAAAAAAAGG - Intronic
1165254844 19:34570143-34570165 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1165361953 19:35342169-35342191 TCTCTATAAGAAGAAGAAGAAGG - Intronic
1165368057 19:35381867-35381889 TCTCTAAAAAAAGAAAGAATGGG - Intergenic
1165416773 19:35699130-35699152 TCTCTAAAAAAACAAAACACAGG + Intergenic
1165425230 19:35741806-35741828 TCTCTAAAAACAAAAAAAACTGG + Intronic
1165927142 19:39333988-39334010 TCTCTACAAAAAAAAAAAAGGGG - Intronic
1166180984 19:41108714-41108736 TCTCTAAAAAAATAAAAAACAGG + Intergenic
1166221948 19:41371001-41371023 TCTCAAAAAAAATAAAAAACAGG - Intronic
1166426896 19:42686995-42687017 TCTCTGCAAGAAGAAAAATATGG + Intronic
1166450624 19:42897340-42897362 TCTCTAAAAGAAAAAAAAAAAGG + Intronic
1166515214 19:43441443-43441465 TCTCTAAAAGAAACAAAAATTGG + Intergenic
1166525896 19:43509493-43509515 TCTCAAGAAAAAAAAAAAAAAGG + Intronic
1166692721 19:44833460-44833482 TCTCAAAAAGAAGAAAGAAAAGG + Intergenic
1166711034 19:44937476-44937498 TCTCAAAAAGAAAAAAAAACAGG + Intergenic
1166721509 19:44999458-44999480 TCTCTACAAAAATAGAAAACAGG + Intergenic
1166723579 19:45011914-45011936 TCTGCGGGAGAAGAAAAAACGGG - Exonic
1166744506 19:45134560-45134582 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
1167070498 19:47219376-47219398 TCTCCAGAAAAAAAAAAAAAAGG - Intergenic
1167292495 19:48631874-48631896 CCTCTAGAAGGAGAAACCACTGG + Intronic
1167318176 19:48778549-48778571 TCTCAAGAAAAAAAAAAAAAAGG + Intergenic
1168067955 19:53930208-53930230 TCTCAAGAAAAAAAAAAAAATGG - Intronic
1168603879 19:57742671-57742693 TCTCTACTAGAAAAAAAAAAGGG - Intronic
1168677281 19:58287864-58287886 TCTCTAAAAAAAAAAAAAAAAGG - Intronic
1168712149 19:58507639-58507661 TCTCTGCAAGAAGAAAAATATGG - Intronic
1202642466 1_KI270706v1_random:107865-107887 TCTGTAGAAGAAGGAAGAACAGG - Intergenic
1202665217 1_KI270708v1_random:112189-112211 TCTCTGCAAGAAGAAAAATATGG + Intergenic
925019357 2:556482-556504 GCTAGAGAAGAAGAAAAACCTGG - Intergenic
925393421 2:3515170-3515192 TCTCTGCAAGAAGAAAAATATGG - Intronic
925408074 2:3620433-3620455 TAGCTAGACGAAGAAAAAAGAGG - Intronic
925521974 2:4756754-4756776 TCTATAGAATACAAAAAAACAGG - Intergenic
925974745 2:9134079-9134101 TCTCTGCAAGAAGAAAAATATGG + Intergenic
926290606 2:11526555-11526577 TCTCTAAAAAAAAAAAAAAAAGG - Intergenic
926324545 2:11773168-11773190 TGTCTAGCAGAAGAAATAAATGG - Intronic
926373681 2:12205503-12205525 TCTCTAGAGAAAAAAAAAATTGG - Intergenic
926404953 2:12541663-12541685 TCTTTTAAAGATGAAAAAACTGG + Intergenic
926574460 2:14564704-14564726 TCTCAAGAAGAAGAAACAGGAGG + Intergenic
926586538 2:14691820-14691842 TCTCTGCAAGAAGAAAAATATGG + Intergenic
926643049 2:15258404-15258426 TCTCTGCAAGAAGAAAAATATGG - Intronic
926672142 2:15586668-15586690 TCTCAAAAAGAAAAAAAAAATGG - Intergenic
926803027 2:16678864-16678886 TCTCAAAAAGAAAAAAAAAATGG - Intergenic
926807947 2:16729218-16729240 TGTCTAGAAGAAAAATAAATGGG + Intergenic
927021559 2:19022277-19022299 TTTCTAAAAGAAGAAAGAAAAGG - Intergenic
927233777 2:20850960-20850982 TCTCAAAAAGAAAAAAAAAATGG + Intergenic
927649063 2:24900110-24900132 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
927675202 2:25100492-25100514 TCTCAAAAAAAAGAAAATACAGG - Intronic
928187590 2:29126422-29126444 TTTATAGAAGAAGAAACAAAGGG - Intronic
928478266 2:31653658-31653680 TCTCAAAAAGAAAAAAAAATTGG - Intergenic
928507930 2:31973151-31973173 TATCTAAAAGAATTAAAAACAGG + Intronic
928521558 2:32094218-32094240 TCTCAAAAAAAAGAAAAAAGAGG - Intronic
928532679 2:32208130-32208152 TCTCAAAAAAAACAAAAAACAGG - Intronic
928570304 2:32600543-32600565 TCTTTGGAAGAACAAAGAACAGG + Intronic
928682407 2:33715916-33715938 TCTCTAAAAAAATAAAATACAGG - Intergenic
929209614 2:39340892-39340914 TCTCCTGAAGGATAAAAAACTGG + Intronic
929350186 2:40941601-40941623 TCTCTGCAAGAAGAAAAATATGG - Intergenic
929692057 2:44083102-44083124 TCTCAAAAAGAAAAAAAAAAGGG + Intergenic
929833225 2:45367217-45367239 TATCTAGAAAACGAAAACACTGG + Intergenic
929923129 2:46187560-46187582 TCTCTCAAAGAAAAAAAAAATGG + Exonic
929938992 2:46316258-46316280 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
930300638 2:49611600-49611622 TCTCTGAAAGAAGAAAAATGTGG - Intergenic
930337491 2:50068331-50068353 TATCTACAAAAAGAAAAAAATGG - Intronic
930423158 2:51178777-51178799 TCTCTGCAAGAAGAAAAATATGG - Intergenic
930663559 2:54079912-54079934 TCTCTGGAAAAAGAAGAAAATGG - Intronic
930948860 2:57112116-57112138 TCTCTAGAAAAATAAAATAATGG - Intergenic
931007754 2:57871701-57871723 ACTCTAGGGGAAGAAAAAAATGG + Intergenic
931023498 2:58078839-58078861 TCTCTAAAATAATAAAAAATGGG - Intronic
931311962 2:61090459-61090481 TCTCTAAAATAAAAAAAAAAAGG - Intronic
931907725 2:66860587-66860609 TCGCTAGTGGAAGAAAAAACTGG + Intergenic
931907761 2:66861098-66861120 ACTCTAGAAGAAGATACAACAGG + Intergenic
931908315 2:66867161-66867183 ACTGTAAAAGGAGAAAAAACAGG + Intergenic
932139117 2:69260067-69260089 TCTCTGCAAGAAGAAAAATATGG - Intergenic
932258008 2:70303320-70303342 TCTCCAAAAGAAAAAAAAAATGG - Intergenic
932391905 2:71399579-71399601 TCTCTAGAAGCCAAAAAGACTGG + Exonic
932395548 2:71444894-71444916 TCTCTGCAAGAAGAAAAATACGG - Intergenic
932484347 2:72073714-72073736 TCTCTGCAAGAAGAAAAATGTGG + Intergenic
932664942 2:73689699-73689721 TCTCAAGATGATGAAAAAAGAGG + Intergenic
932674706 2:73769323-73769345 TATCTATAAAAAGAAAATACAGG + Exonic
933384994 2:81598714-81598736 GCTATAGAAGAAGACATAACAGG + Intergenic
933738223 2:85512403-85512425 TCTCTAAAAAAATGAAAAACAGG - Intergenic
934704392 2:96466591-96466613 TCTCTAAAAGAAAGAGAAACAGG - Intergenic
934889158 2:98051227-98051249 TCTCAAAAAGAAAAAAAACCAGG - Intergenic
934974184 2:98788906-98788928 CATTGAGAAGAAGAAAAAACAGG - Intergenic
935073169 2:99713699-99713721 TCTCTAGAAAAAAAAAAAATAGG - Intronic
935236462 2:101143062-101143084 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
935481127 2:103591774-103591796 TCTCTGCAAGAAGAAAAATATGG - Intergenic
935650847 2:105380742-105380764 TCTCTAGAGGAATTTAAAACCGG - Intronic
935751251 2:106235735-106235757 TCTCTGCAAGAAGAAAAATATGG + Intergenic
936080922 2:109432114-109432136 ACTTTAGAAGAGGAAAACACTGG + Intronic
936816818 2:116470231-116470253 TCTCTACAAGAAGAAAAATATGG + Intergenic
937069908 2:119055211-119055233 TCTCTGCAAGAAGAAAAATATGG + Intergenic
937087831 2:119182969-119182991 TCTCTAACAGAAAAAAGAACAGG + Intergenic
937112119 2:119374465-119374487 TCTCTGCAAGAAGAAAAATATGG + Intergenic
937387970 2:121454282-121454304 TCCCTATAAGAAGAGATAACAGG + Intronic
937485069 2:122307113-122307135 TCTACAGAAGAAAAAAAACCAGG - Intergenic
937606391 2:123806432-123806454 TCTCTGCAAGAAGAAAAATATGG + Intergenic
937629529 2:124084921-124084943 TCTCAAAAAAAAAAAAAAACAGG - Intronic
937735884 2:125288327-125288349 TCTCCAGAAAAAAAAAACACTGG + Intergenic
938154337 2:128919073-128919095 CCTCTAAAATAAGAAAACACTGG - Intergenic
938507513 2:131901888-131901910 TCTCTGCAAGAAGAAAAATATGG + Intergenic
938689924 2:133778081-133778103 TCTTTGGTAGAAGAAAAAAAGGG + Intergenic
938842640 2:135177784-135177806 TCTCTGCAAGAAGAAAAATATGG + Intronic
938959528 2:136328798-136328820 TTTCCAGATGAAGAAAAGACAGG + Intergenic
939133138 2:138262063-138262085 TCTCTGCAAGAAGAAAAATATGG - Intergenic
939306152 2:140414885-140414907 TCTCTGCAAGAAGAAAAATATGG - Intronic
939343769 2:140935430-140935452 GAGCTGGAAGAAGAAAAAACAGG + Intronic
939346666 2:140974971-140974993 TCTAGAGAAGAACAAAGAACTGG + Intronic
939387982 2:141526526-141526548 ACTCTAGAGGAAGAATAAAATGG - Intronic
939404549 2:141739389-141739411 TCTCTACAAGAAGAAAAATGGGG + Intronic
939818131 2:146922011-146922033 TTTCTAGAAAAAAAAAATACTGG - Intergenic
939826628 2:147023383-147023405 TCTCTGCAAGAAGAAAAATATGG + Intergenic
940276116 2:151942578-151942600 TCTCTGCAAGAAGAAAAATATGG - Intronic
940299641 2:152163625-152163647 TCTCTGCAAGAAGAAAAATATGG - Intronic
940434930 2:153640167-153640189 TCTCTAGAAGATGAGGAAGCTGG + Intergenic
940614814 2:156037133-156037155 TGTTTAAAAGAAGAAAAATCAGG + Intergenic
940780309 2:157926253-157926275 TCTCAAAAAAAAGAAAAACCTGG + Intronic
941036177 2:160571260-160571282 TGTCTAGAAGAAAACAAGACAGG - Intergenic
941074033 2:160987214-160987236 TCTCTGCAAGAAGAAAAATATGG + Intergenic
941439263 2:165513101-165513123 TCTCAAAAAGAAAAAAAAATAGG + Intronic
941511438 2:166415911-166415933 TCTCTGCAAGAAGAAAAATATGG - Intronic
941595661 2:167473770-167473792 TGTCTATCAGAAGAATAAACAGG + Intergenic
941786351 2:169503494-169503516 TCTATAAAAAAAGAAAAAAAAGG + Intronic
941979160 2:171435546-171435568 TCTCTAAAAAAAAAAAAAAAAGG - Intronic
942024412 2:171898246-171898268 TGTCTTGAAGAAAAAAAAAAGGG - Intronic
942108663 2:172658571-172658593 TCTCTGCAAGAAGAAAAATATGG - Intergenic
942271972 2:174285498-174285520 TCTCAAGAAAAAAAAAAAATTGG - Intergenic
942395182 2:175539564-175539586 TCTCTAGAATAAGGAAGTACAGG + Intergenic
942582315 2:177431693-177431715 TCTCTGCAAGAAGAAAAATATGG + Intronic
942802191 2:179888691-179888713 TCTCTGCAAGAAGAAAAATATGG - Intergenic
942866511 2:180682311-180682333 TCTCTGCAAGAAGAAAAATATGG + Intergenic
942891579 2:180995970-180995992 TTTGAAAAAGAAGAAAAAACTGG - Intronic
942997154 2:182276702-182276724 TCTCTGCAAGAAGAAAAATATGG - Intronic
943008407 2:182415632-182415654 TCTCTAGAAGAAGTAAAGACAGG - Intronic
943036626 2:182754479-182754501 TATCTTGAAGAAGAATAAAAAGG + Intronic
943171511 2:184407049-184407071 TCTCTGCAAGAAGAAAAACATGG - Intergenic
943636879 2:190316916-190316938 TCTCTAAAAATAGAAATAACAGG - Intronic
943685738 2:190816202-190816224 TCTCTATAAAAAAGAAAAACAGG - Intergenic
944395593 2:199262870-199262892 TCTCTGCAAGAAGAAAAATATGG - Intergenic
944398147 2:199293250-199293272 TCACTAGAAAAAAAGAAAACAGG - Intronic
944511796 2:200472739-200472761 GCGCTAGAAGATGAAGAAACTGG - Intronic
944753342 2:202733616-202733638 TCTCTGTAAGAAGAAAAATATGG + Intronic
944832687 2:203548882-203548904 TCTCCAGAAGAAAAAAGAGCAGG - Intergenic
944885155 2:204055224-204055246 TCTCAAAAAAAAGAAAAAAAGGG + Intergenic
945140845 2:206684747-206684769 ACTCAAGAAGAAGAAGAAAATGG - Intronic
945611565 2:212010934-212010956 TCTCTACAAGAAGAAAAATATGG + Intronic
945723639 2:213448966-213448988 TCTCTGCAAGAAGAAAAATATGG - Intronic
946102470 2:217337924-217337946 TCACTTGAAGAAGGAAAAACTGG + Intronic
946104503 2:217357397-217357419 TCTCTAGAAGAAGAAAGGCTGGG + Intronic
946687959 2:222290857-222290879 TCTTTAAAATAAGAAAAAAATGG + Intronic
946697668 2:222376849-222376871 TCTCAAAAAGAAAAAAAAAAAGG - Intergenic
946714859 2:222542814-222542836 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
946855951 2:223949949-223949971 TCTCAAGAAAAAAAAAAAAAAGG - Intergenic
947071331 2:226291306-226291328 TCTCTGCAAGAAGAAAAATATGG - Intergenic
947171002 2:227311379-227311401 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
947200047 2:227607106-227607128 TCTCAAAAAGAAAAAAAAAGGGG - Intergenic
947341176 2:229141370-229141392 TCTCTGGAAGGAGAATAAAGAGG + Intronic
947642948 2:231717168-231717190 TGTCTAAAAGAAAAAAAAGCTGG - Intergenic
947853271 2:233305884-233305906 TCTCTAAAAGAAAAGAAAACAGG + Intergenic
947963890 2:234262509-234262531 TATCCAGAAGAAAATAAAACTGG - Intergenic
947982175 2:234419985-234420007 TCCGTAGAAGAAAAAAAAAAAGG - Intergenic
948292829 2:236839502-236839524 TCTCTAGAAGATGGAATTACAGG - Intergenic
948339844 2:237240862-237240884 TCTCTGCAAGAAGAAAAATATGG - Intergenic
948488318 2:238295381-238295403 TCTCTAAAAGAAGAAGAAGAAGG - Intergenic
949063661 2:241975880-241975902 TCTCTAAAAGAACTAAAACCTGG - Intergenic
1168743412 20:214793-214815 TCTCAAGAAAAAAAAAAAAGTGG - Intergenic
1168803991 20:662271-662293 CCTCGGGAAGAAGAATAAACAGG + Exonic
1169218965 20:3810049-3810071 TCTCTACAAAAAAAAAAAAAAGG - Intergenic
1169297733 20:4414425-4414447 TCTCCAGAAGATGAAACTACAGG - Intergenic
1169434855 20:5577484-5577506 TCTCCAGAAAAAAAAAAAAAAGG + Intronic
1169532370 20:6499575-6499597 CCTCTATAAGTAGATAAAACTGG - Intergenic
1169568415 20:6880950-6880972 TATTTAGAACAAGAAAATACTGG - Intergenic
1170007878 20:11688124-11688146 TTTCTAAAGGAAGAAAACACAGG - Intergenic
1170433717 20:16301655-16301677 TCTCAAAAAAAAGAAAAAAATGG - Intronic
1170665034 20:18379423-18379445 TCTCAAAAAAAAAAAAAAACAGG - Intergenic
1170909995 20:20556975-20556997 TCTCTAGCAGAAGCAAAAACAGG + Intronic
1170961942 20:21033314-21033336 GCTCAAGAGGAAGAAAAAAATGG + Intergenic
1171009693 20:21502300-21502322 TCTTTAGCAGAAGAAGAAATCGG - Intergenic
1171074541 20:22109197-22109219 TCTCAAAAAAAAGAAAAAATTGG + Intergenic
1171762632 20:29221564-29221586 TCTCTTCAAAAAAAAAAAACTGG + Intergenic
1171889569 20:30698048-30698070 TCTGTAGAAGAAGGAAGAACAGG - Intergenic
1172019891 20:31906649-31906671 TCTCAAAAAAAAGAAAAAAAAGG - Intronic
1172139125 20:32709396-32709418 TCTCAAAAAAAAAAAAAAACAGG + Intronic
1172419170 20:34799235-34799257 GATCAAGAAGAAGAAAAAAATGG + Intronic
1172521757 20:35571431-35571453 TCTAAAGAAGAAAAAAAAAGTGG + Intergenic
1173052172 20:39574061-39574083 TCTCTGGAAGAAAAAAATAATGG - Intergenic
1173589388 20:44212290-44212312 TCTCTTGGACAAGAAAAAGCGGG + Intergenic
1173683015 20:44900211-44900233 TCTACAAAAGAAGAAAAAATTGG - Intronic
1173765674 20:45607391-45607413 TCTCAAGAAGAACAGAAAATGGG - Intergenic
1174127952 20:48321074-48321096 TCTATAGAAGAAAAAAAGACTGG + Intergenic
1174620372 20:51869736-51869758 TCTCAAGAAACAGAAAAAACTGG + Intergenic
1174778159 20:53364546-53364568 CATCCAGAAGAAGAGAAAACTGG - Intronic
1174927496 20:54776692-54776714 AATCTTGAAGAAGAAAAAGCTGG + Intergenic
1175674160 20:60932626-60932648 GCCCAAGAAGAAGAAAAAAAGGG - Intergenic
1175755631 20:61528073-61528095 TTTAAAAAAGAAGAAAAAACAGG + Intronic
1176210276 20:63916862-63916884 TCTCTGCAAGAAGAAAAATATGG + Intronic
1176451428 21:6865597-6865619 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1176458218 21:6931253-6931275 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1176609412 21:8864745-8864767 TCTGTAGAAGAAGGAAGAACAGG + Intergenic
1176772917 21:13098675-13098697 AATATAGAAAAAGAAAAAACTGG + Intergenic
1176829596 21:13730648-13730670 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1176836392 21:13796348-13796370 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1176854360 21:13953376-13953398 TCTGTAGAAGAAGGAAGAACAGG - Intergenic
1176879932 21:14179932-14179954 TCTCTGCAAGAAGAAAAATATGG - Intronic
1176885409 21:14249556-14249578 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1177219791 21:18177362-18177384 ACTCTAGAGTAAGAAGAAACTGG - Intronic
1177237201 21:18407626-18407648 TTTCTACAAAAAGAAAAAAGCGG - Intronic
1177984723 21:27960466-27960488 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1178024531 21:28451270-28451292 GCTCTATGAGAAGAACAAACTGG - Intergenic
1178206296 21:30470426-30470448 TATCCAGAAGCAGAAAAAAATGG + Intergenic
1178597212 21:33964769-33964791 CTTTTAGAAGAAGAAAAAAATGG + Intergenic
1178858290 21:36268326-36268348 TCTCTGCAAGAAGAAAAATATGG + Intronic
1178905849 21:36635392-36635414 TCATTAGAAGAACAAAAACCAGG - Intergenic
1179314650 21:40231804-40231826 TCTTTACAACAAGAAAAAGCTGG - Intronic
1179523369 21:41959677-41959699 TCTCAAGAAAAAAAAAAAAATGG - Intergenic
1179630136 21:42672642-42672664 TGTTTAGAAAAAGAGAAAACTGG + Intronic
1180234457 21:46449177-46449199 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1180331936 22:11489109-11489131 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1180359506 22:11874591-11874613 TCTGTAGAAGAAGGAAGAACAGG + Intergenic
1180520560 22:16198394-16198416 AATATAGAAAAAGAAAAAACTGG + Intergenic
1180634767 22:17255431-17255453 TCTCAAAAAAAAAAAAAAACAGG + Intergenic
1180642186 22:17307883-17307905 TCTCAAAAAAAAGAAAACACAGG + Intergenic
1180707037 22:17816443-17816465 TCTTGTGAAGAAGAAAAGACTGG - Intronic
1180767696 22:18355956-18355978 TCTCTAAAAGAAAAAAAAATTGG - Intergenic
1180778612 22:18506434-18506456 TCTCTAAAAGAAAAAAAAATTGG + Intergenic
1180811337 22:18763742-18763764 TCTCTAAAAGAAAAAAAAATTGG + Intergenic
1180824021 22:18850917-18850939 TCTCTAAAAGAAAAAAAAATTGG + Intronic
1180990849 22:19935110-19935132 TCTCTGCAAGAAGAAAAATATGG - Intronic
1181188717 22:21123631-21123653 TCTCTAAAAGAAAAAAAAATCGG - Intergenic
1181210482 22:21286862-21286884 TCTCTAAAAGAAAAAAAAATCGG + Intergenic
1181399027 22:22640029-22640051 TCTCTAAAAGAAAAAAAAATTGG - Intergenic
1181501757 22:23319375-23319397 TCTCTAAAAGAAAAAAATATCGG - Intergenic
1181536200 22:23547242-23547264 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1181650393 22:24256030-24256052 TCTCTAAAAGAAAAAAAAATTGG + Intergenic
1181906166 22:26198641-26198663 TCTCTGGAAGATGCAACAACAGG - Intronic
1181947179 22:26527456-26527478 TCTCCAGATGAAGAAAACAGGGG + Intronic
1182163847 22:28151954-28151976 TCTCAAGTAGAAGAACTAACTGG + Intronic
1182658015 22:31905182-31905204 TCTCAAAAAGAAAAAAAAAGAGG - Intronic
1182997355 22:34826458-34826480 TCTTTAAAAGCAGAAAAAAAAGG + Intergenic
1183290095 22:36995937-36995959 TGTCTATAAGCAGGAAAAACAGG - Intronic
1183570888 22:38652584-38652606 TCTCAAGAAAAAAAAAAAAAAGG + Intronic
1183592889 22:38791163-38791185 CCTCTAGAAAAAAAAAAAAAAGG + Intronic
1183917830 22:41137056-41137078 TCTCAAGAAGGAAAAAAAAATGG + Intronic
1183968849 22:41460718-41460740 TCTCTTGAAAAAAAAAAAATTGG + Intronic
1184081537 22:42224657-42224679 TATGTATTAGAAGAAAAAACTGG + Intronic
1184618063 22:45651624-45651646 CCTCTAAAAGTAGAAAAGACAGG + Intergenic
1184909751 22:47522250-47522272 TCTCAAGAAAAAAAAAAAAAAGG - Intergenic
1185074283 22:48674940-48674962 TCTCAAAAAAAAAAAAAAACTGG - Intronic
1185353176 22:50348888-50348910 TCTCTACAAAAACAAAAAGCAGG + Intronic
1203216464 22_KI270731v1_random:8568-8590 TCTCTAAAAGAAAAAAAAATTGG - Intergenic
1203229311 22_KI270731v1_random:96839-96861 TCTCTAAAAGAAAAAAAAATTGG - Intergenic
949213592 3:1536854-1536876 TCTCTGCAAGAAGAAAAATATGG - Intergenic
949226802 3:1704797-1704819 TCTCTTTAAGAATTAAAAACAGG - Intergenic
949231363 3:1754673-1754695 TCTCTGCAAGAAGAAAAATATGG + Intergenic
949269519 3:2198022-2198044 TCTCTGGAAAAAAAAAAAAAAGG + Intronic
949366897 3:3291688-3291710 TCTCTGCAAGAAGAAAAATATGG - Intergenic
949488110 3:4560597-4560619 TCTCTGGAAGAAGAGAGAACTGG + Intronic
949662838 3:6301128-6301150 TCTCTAGAAGGAGTAATAATAGG + Intergenic
950007596 3:9701518-9701540 TCTCAAGAAAAAAAAAAAAAAGG + Intronic
950322284 3:12067891-12067913 TCTCTACAAAAAGAAAAATTAGG + Intronic
950427864 3:12934407-12934429 AGTCTAGAAGAAGAGAGAACAGG + Intronic
950657027 3:14442936-14442958 TCTCTAGCAGAAAAAAATAAGGG - Intronic
950807605 3:15620425-15620447 TCTCTGCAAGAAGAAAAATGTGG + Intronic
951081039 3:18449962-18449984 TCTCTGCAAGAAGAAAAATATGG + Intergenic
951539225 3:23766408-23766430 TCTCAAAAAGAAGAAGAAAAAGG - Intergenic
951859601 3:27237119-27237141 TCTCTGCAAGAAGAAAAATATGG + Intronic
951978530 3:28541081-28541103 TCTCTGCAAGAAGAAAAATATGG + Intergenic
952288825 3:31995432-31995454 TCTCTGCAAGAAGAAAAATATGG + Intronic
952293816 3:32043264-32043286 TCTCTGCAAGAAGAAAAATATGG + Intronic
952483265 3:33784052-33784074 TCTGGAGAGGGAGAAAAAACAGG - Intergenic
952558608 3:34562541-34562563 TCAATAGAAGAACAAAAAGCTGG - Intergenic
953119522 3:40026244-40026266 TCTCTGCAAGAAGAAAAATATGG + Intronic
953172545 3:40520697-40520719 TCTCTTAAAAAAGAAAAAAATGG - Intergenic
953611698 3:44452325-44452347 TTATTAGAAGAATAAAAAACGGG - Intronic
953987959 3:47460057-47460079 TCTCTGCAAGAAGAAAAATATGG + Intronic
954069545 3:48132936-48132958 TCTCAAAAAAAAAAAAAAACTGG - Intergenic
954738637 3:52728696-52728718 TCTCTGCAAGAAGAAAAATATGG - Intronic
954835357 3:53462185-53462207 TCTCTAAAAAAAAAAAAAAGTGG - Intergenic
954857441 3:53658277-53658299 TCTCTATAAAATGACAAAACTGG - Intronic
954900433 3:54014640-54014662 TCTCTAAAGGAAAAAAAAAGAGG - Intergenic
955098555 3:55824067-55824089 TCCTTAGAAGAAGAAGAAAATGG - Intronic
955275237 3:57540926-57540948 TCTCAAAAAGAAAAAAAAAAAGG + Intronic
955302210 3:57791352-57791374 TCTCAAAAAGAAAAAAAAAAAGG + Intronic
955707420 3:61742811-61742833 ACTCAAAAAGAATAAAAAACTGG - Intronic
956260281 3:67331720-67331742 TCTCTAAAAAAAAAAAAAAAAGG + Intergenic
956496782 3:69835575-69835597 ACTCTACTAGAAGAAAACACAGG - Intronic
956524844 3:70146834-70146856 AAGCTAGAAGAAGAAATAACAGG + Intergenic
958006461 3:87818460-87818482 TCTCCAGCAGCAGAAAAATCTGG + Intergenic
958193932 3:90218901-90218923 TCTCTGAAAGAAGAAAAATATGG - Intergenic
958417282 3:93889955-93889977 TCTCTGCAAGAAGAAAAATATGG - Intronic
958424362 3:93964271-93964293 TCTCTGCAAGAAGAAAAATATGG - Intronic
958493807 3:94815642-94815664 TATCTAGAAGAAAGAAACACTGG - Intergenic
958497165 3:94860323-94860345 TCTCTGCAAGAAGAAAAATATGG - Intergenic
958714650 3:97764803-97764825 TCTCTAGAAGTTGGGAAAACCGG - Exonic
958970256 3:100603309-100603331 GCTCTAGAAGATGAAAGAAAAGG - Intergenic
959005273 3:101012637-101012659 TCTCTGCAAGAAGAAAAATATGG + Intergenic
959220083 3:103507036-103507058 TCTCTGCAAGAAGAAAAATATGG + Intergenic
959498506 3:107078551-107078573 TCTGTAGAAAAATAAAACACTGG - Intergenic
959542061 3:107551387-107551409 TCTTTAAAAGAAGAAAAAGATGG - Intronic
959542726 3:107558484-107558506 TCTCAAAAACAACAAAAAACAGG + Intronic
959613553 3:108321742-108321764 TCTAGAGAAAAAGAGAAAACAGG - Intronic
959640716 3:108629948-108629970 TTTATATAAGAAGGAAAAACTGG - Intronic
959671775 3:108986493-108986515 TTACTAAAAGATGAAAAAACGGG + Intronic
959703902 3:109322726-109322748 TCTCAAGAAAAAAAAAAAGCCGG + Intergenic
959887970 3:111524497-111524519 TCTCTGCAAGAAGAAAAATGTGG - Intronic
959888628 3:111529802-111529824 TCTCTGCAAGAAGAAAAATATGG - Intronic
959963319 3:112326266-112326288 TCTCAAGAATAAGAAAAAATAGG - Intergenic
960166663 3:114410511-114410533 TCTCCAGAACAAAAACAAACAGG + Intronic
960500216 3:118428899-118428921 TCTCAAGAAAAAGAAGAAAAAGG + Intergenic
960530839 3:118762606-118762628 TGTCTTGCAGAAGAGAAAACAGG + Intergenic
960646337 3:119888701-119888723 TCTCTGCAAGAAGAAAAATATGG - Intronic
961025099 3:123548622-123548644 TCTCAAAAAGAAAAAAAAACTGG - Intronic
961030832 3:123602257-123602279 TCTCTAAAAAAAGAATAAAAAGG - Intergenic
961950844 3:130747579-130747601 TCTCCAAAAGAAAAAAAAAAAGG - Intergenic
962058306 3:131897890-131897912 TCTCTTAAAGAAAAAAAAAGAGG + Intronic
962497607 3:135957596-135957618 TCTCTGCAAGAAGAAAAATATGG + Intergenic
962624054 3:137207905-137207927 TCTTTAAAAGGAGAAAAAGCTGG + Intergenic
962758560 3:138486911-138486933 TCTCTGCAAGAAGAAAAATATGG + Intergenic
963091042 3:141484335-141484357 TGTCTGGAAGAACAAAAAAGTGG + Intergenic
963222323 3:142826004-142826026 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
963391314 3:144666821-144666843 TCCCTAGAAGATCAAGAAACTGG - Intergenic
963764830 3:149323828-149323850 TCTCTGCAAGAAGAAAAATATGG - Intronic
964437701 3:156672128-156672150 ACTCTAGAAGAAAGAAAAAAAGG + Intergenic
964781971 3:160349445-160349467 TCTCAAAAAGAAAAAAAAAAAGG + Intronic
965209712 3:165768931-165768953 TCTGAAGAAGTAGAAAAAACAGG - Intergenic
965893513 3:173544854-173544876 TCCCTAGAATTAGAAAGAACGGG + Intronic
966029343 3:175325922-175325944 TTTCTAGGAGAAGAAAGAAAGGG - Intronic
966138646 3:176729919-176729941 TCTCAAAAAGAAAAAAAAAAAGG + Intergenic
966146278 3:176815424-176815446 TCTCTATAACATGAAAAAAAAGG + Intergenic
966189208 3:177256397-177256419 TCTCTAAAAAAAAAAAAAAAGGG - Intergenic
966247256 3:177823544-177823566 TCTCAAAAAGAAAAAAAAAAAGG - Intergenic
966351713 3:179038411-179038433 TCTCTAAAAAAAGAAAAATGAGG + Intronic
966453660 3:180091359-180091381 TCTCAAGAAAAAAAAAAAAAAGG - Intergenic
966685304 3:182687160-182687182 GCTGTAGATGAAGAAAGAACTGG + Intergenic
967300900 3:188011021-188011043 TCTCTGCAAGAAGAAAAATATGG + Intergenic
967508630 3:190283652-190283674 TCTCTAGACTAAGAAAAAAAGGG - Intergenic
967635975 3:191803734-191803756 TCTGTAAAAGAAGATTAAACTGG + Intergenic
967702015 3:192604107-192604129 TCTCTGCAAGAAGAAAAATATGG + Intronic
967778797 3:193413480-193413502 TCTCTGCAAGAAGAAAAATATGG - Intronic
968024491 3:195427903-195427925 TCTCAAAAAAAAGAAAAAACAGG + Intronic
968803369 4:2756922-2756944 TCTCAAAAAGAAGAAAAAAAAGG - Intergenic
969270948 4:6101289-6101311 TATCTGTAAGAAAAAAAAACAGG - Intronic
969371871 4:6736758-6736780 TCTCTCAAAGAAAAAAAAAGGGG - Intergenic
969411250 4:7029821-7029843 TCTCAAAAAGAAGAAAAAGAAGG + Intronic
969783460 4:9431503-9431525 TCTGAGCAAGAAGAAAAAACAGG + Intergenic
970058006 4:11996940-11996962 TCTCTGCAAGAAGAAAAATATGG + Intergenic
970115632 4:12692082-12692104 CCACTAGTAGAAGTAAAAACTGG - Intergenic
970448591 4:16145007-16145029 TCTCTGCAAGAAGAAAAATAAGG - Intergenic
970546997 4:17139983-17140005 TCTCTACAAGAAGAAAAATATGG - Intergenic
970739372 4:19216219-19216241 TCTTTAAAAAAAAAAAAAACAGG - Intergenic
970940023 4:21620991-21621013 TCTCTATAAGAAGAAAAAGTAGG - Intronic
970940147 4:21622271-21622293 TCTCTGGGACAAGAAAAAACGGG + Intronic
970956463 4:21817525-21817547 TCTCTGCAAGAAGAAAAATATGG - Intronic
970980168 4:22086793-22086815 TCTCTGCAAGAAGAAAAATATGG + Intergenic
971319951 4:25597460-25597482 TCTCTGCAAGAAGAAAAATATGG + Intergenic
971339906 4:25758631-25758653 TTTCTAGTAGAAGAAAATCCTGG + Intronic
971405194 4:26315891-26315913 TCTCTGCAAGAAGAAAAATATGG + Intronic
971470007 4:27013507-27013529 TCTCTAAAAGTAGAAAAGAATGG - Intronic
971592040 4:28480742-28480764 TCTGTAGGAGAATTAAAAACAGG - Intergenic
971753868 4:30683167-30683189 TCTCTGCAAGAAGAAAAATATGG + Intergenic
971788220 4:31133008-31133030 TATTTAGAAGAAAAGAAAACAGG - Intronic
971825235 4:31612986-31613008 TCTTTATAACAAGATAAAACTGG - Intergenic
971846699 4:31928128-31928150 TCTCTGCAAGAAGAAAAATACGG - Intergenic
972456683 4:39262406-39262428 TCTCTACAAAAATAAAAAATTGG - Intronic
972487202 4:39553592-39553614 TCTCAAAAAAAAAAAAAAACCGG - Intronic
972940674 4:44191449-44191471 TCTCTGCAAGAAGAAAAATATGG - Intronic
972980396 4:44692747-44692769 GACATAGAAGAAGAAAAAACTGG - Intronic
973024337 4:45248467-45248489 TCTCTGCAAGAAGAAAAATATGG + Intergenic
973223342 4:47753648-47753670 TCTCTGCAAGAAGAAAAATATGG + Intronic
973659134 4:53084315-53084337 TCTCTGCAAGAAGAAAAATATGG + Intronic
974164678 4:58185859-58185881 TCTCTGCAAGAAGAAAAATATGG + Intergenic
974185533 4:58440762-58440784 TCTCTGCAAGAAGAAAAATATGG + Intergenic
974230812 4:59111507-59111529 TCTCTGCAAGAAGAAAAATATGG - Intergenic
974645569 4:64687123-64687145 TCTCTGCAAGAAGAAAAATATGG - Intergenic
974673485 4:65061046-65061068 TTACTAGATGAAGAAAAAAACGG - Intergenic
974734157 4:65907273-65907295 TCTGTAGAATAACAAGAAACAGG + Intergenic
974741378 4:66012741-66012763 TCTCTGCAAGAAGAAAAATATGG - Intergenic
975016322 4:69425081-69425103 TCTCTGAAAGAAGAAAAATATGG + Intergenic
975228632 4:71905350-71905372 TCTCTGAAAGAAGAAAAATATGG - Intergenic
975307713 4:72867867-72867889 TCTCTGCAAGAAGAAAAATGTGG + Intergenic
975694155 4:76995081-76995103 TCTCTAAAAAAAAAAAAAAATGG + Intronic
975729149 4:77320608-77320630 TCTCTGCAAGAAGAAAAATATGG + Intronic
975790655 4:77946234-77946256 TCTCTGCAAGAAGAAAAATATGG + Intronic
975897885 4:79117068-79117090 TCTCTGCAAGAAGAAAAATATGG - Intergenic
976067297 4:81203114-81203136 TCTCTAACAGAAGAGAACACTGG + Intronic
976636792 4:87294215-87294237 TCTCTGCAAGAAGAAAAATATGG + Intergenic
976759131 4:88529453-88529475 TCTCTAAAAAATAAAAAAACAGG + Intronic
977045330 4:92062057-92062079 TCTCTAGACGGAAAAAAAATAGG - Intergenic
977251705 4:94695776-94695798 TCTCAAAAAGAAAAAAAAAAAGG - Intergenic
977472980 4:97465347-97465369 TCTTTACAATAAGAAAAATCTGG - Intronic
977605401 4:98979490-98979512 TATCAAGAAGAAGAACATACAGG - Intergenic
977720249 4:100231234-100231256 TCTCTGCAAGAAGAAAAATATGG + Intergenic
977811762 4:101363887-101363909 AATCTTGAAGAAGAGAAAACGGG - Intergenic
977901887 4:102431858-102431880 TTAGTAGAAGAAGAAAAAATTGG - Intergenic
978279604 4:106994598-106994620 TCTATAGAAGAAAAAATAACTGG + Intronic
978325086 4:107544496-107544518 TCTCTAGAGTCAGAAAAACCTGG + Intergenic
978333453 4:107641012-107641034 GCCCTAGAAGGAAAAAAAACAGG + Intronic
978381921 4:108138075-108138097 TCTGTTGAAGAAGCAAAAATAGG - Intronic
978467249 4:109021655-109021677 TCTCTGCAAGAAGAAAAATATGG - Intronic
978606773 4:110489204-110489226 TCTGGAGAAAAAAAAAAAACAGG + Intronic
978796066 4:112709135-112709157 TTACAAGAAGAAGAAAAAAAGGG - Intergenic
979027194 4:115592598-115592620 TCTCTGAAAGAAGAAAAATGTGG - Intergenic
979075071 4:116260789-116260811 TCTCTGCAAGAAGAAAAATATGG - Intergenic
979533859 4:121797816-121797838 TCTCAAAAAAAAGAAAAAAATGG - Intergenic
979592801 4:122499861-122499883 TATTTGTAAGAAGAAAAAACTGG - Intergenic
979765567 4:124461636-124461658 TCTCTGCAAGAAGAAAAATATGG - Intergenic
979793224 4:124812543-124812565 TCTCTGCAAGAAGAAAAATATGG + Intergenic
980017215 4:127663813-127663835 TCTGTAGGAAAAGAAAAAAGAGG + Intronic
980070016 4:128234108-128234130 TCTCAAAAAAAAGAAAGAACTGG + Intergenic
980180959 4:129399911-129399933 TCTCTGCAAGAAGAAAAATATGG + Intergenic
980581593 4:134761579-134761601 GGTCTAGGAGAAGAAAAAAGTGG + Intergenic
980600610 4:135019443-135019465 TCTCTGAAAGAAGAAAAATATGG + Intergenic
980954491 4:139414637-139414659 TCTCTGCAAGAAGAAAAATATGG - Intronic
980979038 4:139638341-139638363 TCTCTGCAAGAAGAAAAATATGG - Intergenic
981090100 4:140723335-140723357 TCTCAAGAACAAAAAAAATCTGG - Intronic
981401229 4:144315579-144315601 TCTCTGCAAGAAGAAAAACATGG + Intergenic
981754143 4:148122985-148123007 TCTCTGCAAGAAGAAAAATATGG - Intronic
981990527 4:150914341-150914363 TCTGTAAAAGAAAAAAAAAAAGG + Exonic
982253213 4:153428100-153428122 TCTCAAAAAGAAAAAAAAAAAGG - Intergenic
982376682 4:154698582-154698604 TCTCTGCAAGAAGAGAAAGCTGG - Intronic
982480163 4:155898808-155898830 TCTCTGCAAGAAGAAAAATGTGG + Intronic
982618039 4:157666649-157666671 TCTATAAAAGAAAAAAAAAATGG - Intergenic
982649700 4:158072425-158072447 TCTCTAAAAAAAAAAAAAAAAGG + Intergenic
982696392 4:158606749-158606771 TCTCTAAAAAAAAAAAAAAAAGG - Intronic
982727429 4:158920376-158920398 TCTCTACAAGAAGAAAAATATGG - Intronic
982739882 4:159046225-159046247 TCTCAAGAAAAAAAAAAAAAGGG + Intergenic
982887390 4:160798536-160798558 TCTCTGCAAGAAGAAAAATATGG + Intergenic
983032228 4:162817412-162817434 TCTCTGCAAGAAGAAAAATATGG - Intergenic
983072669 4:163288032-163288054 TCTTAAGAAGATGAAAAAGCAGG + Intergenic
983189574 4:164740739-164740761 TCTCTGCAAGAAGAAAAATATGG - Intergenic
983190911 4:164752590-164752612 TCTCTGCAAGAAGAAAAATATGG - Intergenic
983252691 4:165362517-165362539 TCTCCAGAAAAAAAAAAAAAAGG + Intronic
983503936 4:168531892-168531914 TCTTTAAAAAAAGAAAAAAAAGG - Intronic
983759548 4:171387897-171387919 TCTCTGCAAGAAGAAAAATGTGG + Intergenic
984157763 4:176212218-176212240 TCTCTGCAAGAAGAAAAATATGG - Intergenic
984314978 4:178117698-178117720 TCTCTAGCAAAAGAAACTACAGG - Intergenic
984661767 4:182382231-182382253 TATTTATAAGAAGAAAAAAGGGG + Intronic
984739172 4:183142588-183142610 TCTCTAAAAGAATACAAAACTGG - Intronic
984790554 4:183611060-183611082 CTTCTAGAAAATGAAAAAACAGG + Intergenic
984908586 4:184651287-184651309 TCTCAAAAAAAAGAAAAAAAAGG + Intronic
985115010 4:186582111-186582133 TCTCTGCAAGAAGAAAAATAGGG - Intergenic
1202769831 4_GL000008v2_random:193763-193785 TCTGTAGAAGAAGGAAGAACAGG - Intergenic
985533701 5:449275-449297 ATTTTAGAAGAAGAAAAAATGGG - Intronic
986096376 5:4558101-4558123 TGTCCAGTAGAAGAAAACACTGG - Intergenic
986583372 5:9288573-9288595 TCTTTCGAAGATGATAAAACAGG + Intronic
987005028 5:13702016-13702038 TCTCTTGAAGGAGCAAAAAATGG + Intronic
987780421 5:22427070-22427092 TCTCTAAAAGAGGAAAGAAGAGG - Intronic
987799779 5:22679348-22679370 TCTTTAGAGGAAGAAAGAAAAGG - Intronic
987902510 5:24031226-24031248 TCTCTGCAAGAAGAAAAATATGG - Intronic
987955819 5:24738645-24738667 TTCCTAGAAAAAGAAAAAAATGG - Intergenic
988216599 5:28282658-28282680 TTTTTAAAAGAAAAAAAAACAGG - Intergenic
988545371 5:32152126-32152148 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
988723899 5:33906280-33906302 TCTCTGCAAGAAGAAAAATATGG - Intergenic
989071462 5:37516201-37516223 TCTTTAGAAGAAAAAAAGAAAGG - Intronic
989420251 5:41230275-41230297 TCTCTGCAAGAAGAAAAATATGG - Intronic
989637808 5:43555999-43556021 TCTGCAAAAGAAAAAAAAACGGG + Exonic
990079676 5:51898078-51898100 TATCTATAATAATAAAAAACTGG + Intergenic
990090408 5:52039489-52039511 TCTCTGGAAAAAAAAAAAGCTGG - Intronic
990114653 5:52373905-52373927 CCTCTGGATGAAGAATAAACAGG + Intergenic
990466543 5:56076572-56076594 TCTCCTGAAGAAAAAAAAACTGG + Intergenic
990467497 5:56083866-56083888 TCTCAAAAAAAAAAAAAAACTGG - Intergenic
990704535 5:58513759-58513781 TCTCTGCAAGAAGAAAAATATGG - Intergenic
991101400 5:62797390-62797412 TCTCTGGAAGAAGAAAAATATGG + Intergenic
991132838 5:63144881-63144903 TTACAAGAAGAACAAAAAACTGG - Intergenic
991264072 5:64696464-64696486 TCTCTGCAAGAAGAAAAATATGG - Intronic
991349795 5:65709379-65709401 TCTCAAAAAAAAAAAAAAACTGG - Intronic
991435271 5:66591845-66591867 TCTCTAGGAGAATAAGAAACAGG + Intergenic
991542643 5:67746645-67746667 TCTCTACAAGAAGAAAAATATGG + Intergenic
991624547 5:68586558-68586580 TCTCAAAAAGAAAAAAAAAAAGG - Intergenic
991668030 5:69019505-69019527 TCACTAGAAGAAGAGAAGGCAGG - Intergenic
991722963 5:69511074-69511096 TCTCAAAAAGAAAAAAAAAATGG - Intronic
992108799 5:73473168-73473190 TCTCAAAAAGAAAAAAAAAAAGG - Intergenic
992271012 5:75062911-75062933 TCCGTATAAGAAGAAAAAATTGG - Intergenic
992282568 5:75196900-75196922 TCTCAAAAAAAAGAAAAAAAAGG - Intronic
992504995 5:77378052-77378074 TCTCTAGACAAAGAACCAACAGG - Intronic
992600758 5:78396948-78396970 TATCTTTAAGAAGAAAGAACTGG + Intronic
992608635 5:78488115-78488137 TCTCCAGAAGAAGAGGAGACTGG + Exonic
992731574 5:79675075-79675097 TCTCTAGAGCAGAAAAAAACAGG + Intronic
993155177 5:84213633-84213655 TGTCTAGAGAAAGAAAAAACAGG + Intronic
993354095 5:86884584-86884606 ACTCAACAAGAATAAAAAACTGG - Intergenic
993695960 5:91062078-91062100 TCTCTAAAAGAAGAACAATGTGG - Intronic
994112632 5:96024149-96024171 ATTCTAGAGGAAGAACAAACAGG - Intergenic
994136539 5:96293619-96293641 TCTCTGGAAGGAGAAGAAAGAGG - Intergenic
994386958 5:99143865-99143887 TCTCTGCAAGAAGAAAAATATGG + Intergenic
994415619 5:99466774-99466796 TCTCAAGAAAAAAAAAAAAATGG - Intergenic
994535563 5:101025564-101025586 GGCCTAGAAGAAGAAAAAAATGG - Intergenic
994615460 5:102099127-102099149 TCTCTGCAAGAAGAAAAATATGG + Intergenic
994649646 5:102510489-102510511 ACTCTAGAAGGAGATAAAATGGG + Intergenic
994875834 5:105419667-105419689 TCTCTGCAAGAAGAAAAATATGG + Intergenic
994949071 5:106433366-106433388 TATCTAGAAGTGGAAAATACTGG + Intergenic
995130608 5:108626547-108626569 TCAAAAGAAGAAGAAAAATCAGG + Intergenic
995167126 5:109056880-109056902 TCTGAAAAAGAAGAATAAACCGG - Intronic
995187440 5:109286955-109286977 TCTCTGCAAGAAGAAAAATATGG + Intergenic
995238946 5:109863693-109863715 TCTCCAAAAGAATAAGAAACAGG - Intronic
995323925 5:110870367-110870389 ACGCTATATGAAGAAAAAACTGG + Intergenic
995406041 5:111797421-111797443 TCTAGAGAAGAAGAAAAATTTGG + Intronic
995885770 5:116892482-116892504 TCTCAAAAAAAAGAAAAAAAAGG + Intergenic
995933772 5:117483961-117483983 TTTCTAGCAGAAGAAACAAAGGG - Intergenic
996044268 5:118852130-118852152 TCTCTGCAAGAAGAAAAATATGG + Intronic
996097436 5:119413895-119413917 TCTCTGCAAGAAGAAAAATATGG - Intergenic
996101680 5:119451167-119451189 TCTCTGCAAGAAGAAAAATATGG + Intergenic
996137757 5:119865721-119865743 TCTTTACAACAAGAAAAAGCTGG - Intergenic
996401431 5:123067547-123067569 TACCCAGAAGAACAAAAAACAGG - Intergenic
996431591 5:123385616-123385638 TCTCAAAAAAAAAAAAAAACAGG - Intronic
996517093 5:124382896-124382918 TCTCTGCAAGAAGAAAAATATGG - Intergenic
996529327 5:124511139-124511161 TCTCAAGAAAAAGGAAAAAAGGG + Intergenic
996759286 5:126971146-126971168 TTGCTTTAAGAAGAAAAAACAGG + Intronic
996867137 5:128137937-128137959 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
996971497 5:129374110-129374132 TCTCCAAAAGAAAAAAAAAAAGG + Intergenic
997004233 5:129799686-129799708 TCTCTGCAAGAAGAAAAATATGG + Intergenic
997019123 5:129976189-129976211 TCTCTCGAAGAAGAAATATGTGG + Intronic
997111742 5:131082717-131082739 TATCTAAAAGAAAAAAAAAAAGG - Intergenic
997151865 5:131505287-131505309 TCTTTTGAGGAAGACAAAACAGG + Intronic
997180055 5:131819299-131819321 TCTCCAGAATAAAAAAATACCGG + Intronic
997573865 5:134957689-134957711 TCTCTATAAAAATAAAAAACAGG + Intronic
997736968 5:136220283-136220305 TCTCTGCAAGAAGAAAAATATGG - Intronic
997753945 5:136377122-136377144 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
997924195 5:138013199-138013221 TCTCAAAAAGAAAAAAAAAAAGG + Intronic
997969125 5:138385923-138385945 TCTCTAGAAGCAGACAAAGCAGG - Intronic
998440031 5:142151517-142151539 CCTCTAGAACTAGAAAAAACTGG - Intronic
999263678 5:150253056-150253078 TTTATAGATGAGGAAAAAACTGG - Intronic
999847612 5:155502145-155502167 ACTCTAAAAGAAGACAAAAATGG + Intergenic
999848273 5:155509083-155509105 TCTCTATAAAAATAAAAAAGGGG - Intergenic
999885559 5:155919199-155919221 TGTCTATAAGAAGAAAAGATTGG - Intronic
999923523 5:156349389-156349411 TCTAAACAAGAAAAAAAAACAGG + Intronic
999989762 5:157038951-157038973 TCTCCAGAAAAAAATAAAACTGG + Intronic
999998855 5:157118738-157118760 TCTCAAAAAGAAAAAAAAAATGG - Intronic
1000298633 5:159934814-159934836 TCTCAAAAAAAAAAAAAAACAGG + Intronic
1000400951 5:160826638-160826660 TCTCTGCAAGAAGAAAAATATGG - Intronic
1000748071 5:165060387-165060409 CCTCGAGAAGAACAAACAACAGG - Intergenic
1000880649 5:166693144-166693166 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1001199806 5:169705812-169705834 TCTCTGCAGGAAGAAAAACCAGG - Intronic
1001255569 5:170180976-170180998 TCTCAAAAAGAAAAAAAAAAGGG - Intergenic
1001719976 5:173848803-173848825 TAGCTAGAAGAAGAAGAAGCTGG - Intergenic
1001739588 5:174041114-174041136 TAGCTGGAAGAAGAAAAAATAGG + Intergenic
1001867707 5:175119881-175119903 TCTCTAGAAAAAAAAAATTCTGG - Intergenic
1001870118 5:175146763-175146785 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1002311919 5:178320117-178320139 TGTCTGGAAGAAGATAAAAGAGG - Intronic
1002590564 5:180289109-180289131 TCTCAAGAAGAAAAAAAATCTGG + Intronic
1002666397 5:180828790-180828812 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1003367099 6:5485130-5485152 TCTGTAGAAGCTGAAAAAAATGG - Intronic
1003452107 6:6244480-6244502 TCTCTAGATGATGAGAATACAGG + Intronic
1003549833 6:7093240-7093262 TCTCAAGAAGAAAAAAAAAGTGG + Intergenic
1003963413 6:11230233-11230255 TTTCTGGGAGAAGAAAACACTGG + Intronic
1004086471 6:12454209-12454231 TCTCTGCAAGAAGAAAAACATGG + Intergenic
1004672097 6:17807242-17807264 TCTCTGCAAGAAGAAAAATATGG - Intronic
1005137634 6:22588556-22588578 GCTTTAGAAAAAGAAAAAACTGG - Intergenic
1005186633 6:23169900-23169922 TCTTTAAAACAAGAAAAAGCTGG + Intergenic
1005373384 6:25157865-25157887 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1006020208 6:31113286-31113308 CCTCTAGAAGGTGAAAAAGCAGG - Intergenic
1006292738 6:33152494-33152516 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1006545419 6:34776848-34776870 TCTCAAAAAAAAAAAAAAACCGG + Intergenic
1006605747 6:35256414-35256436 TGTCTATAAAAATAAAAAACAGG + Intergenic
1006637284 6:35469495-35469517 ACTCAACAAGAATAAAAAACTGG + Exonic
1007022010 6:38529935-38529957 TCTCTGCAAGAAGAAAAATATGG - Intronic
1007038392 6:38699504-38699526 TCTCTGCAAGAAGAAAAATATGG - Intronic
1007497030 6:42267328-42267350 TGTCTAAAAAAAGAAAAAAGGGG + Intronic
1007983872 6:46188112-46188134 TCTCAAAAAGAAAAAAAAAAAGG - Intergenic
1008244746 6:49157764-49157786 CATTTAGTAGAAGAAAAAACTGG + Intergenic
1008887823 6:56450240-56450262 TCTCCAGAAGCAATAAAAACTGG + Intergenic
1008955141 6:57207467-57207489 TCTTTAGAAGAATAATGAACTGG + Intronic
1009430501 6:63560401-63560423 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
1009447221 6:63757099-63757121 TCTCTGCAAGAAGAAAAATATGG - Intronic
1009490976 6:64290333-64290355 TATAAAGTAGAAGAAAAAACAGG + Intronic
1009640324 6:66326968-66326990 TCTCAAGAAAAAAAAAAAAAAGG + Intergenic
1009720201 6:67458630-67458652 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1009789631 6:68385345-68385367 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1010169192 6:72955003-72955025 TATCTGGAGGAAGAAAACACAGG - Intronic
1010210239 6:73356986-73357008 TCTCAAAAAAAAAAAAAAACAGG + Intergenic
1010291269 6:74140899-74140921 TCCCTAGAAGAATAATAAATTGG + Intergenic
1010465032 6:76157831-76157853 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1010520298 6:76824042-76824064 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1010762902 6:79745077-79745099 TCTCTAAAAAAAAAAAAAAGAGG + Intergenic
1010776428 6:79891386-79891408 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1010796564 6:80123082-80123104 TCTCTGCAAGAAGAAAAATATGG + Intronic
1010803926 6:80212415-80212437 TCTCTGCAAGAAGAAAAATGTGG + Intronic
1010810563 6:80294484-80294506 TCTCTGCAAGAAGAAAAATATGG - Intronic
1010816642 6:80365517-80365539 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1011056735 6:83213032-83213054 TCTCAAAAAAAAAAAAAAACTGG - Intronic
1011186910 6:84687678-84687700 TCTGTAGAACAAGAAAGAAAGGG + Intronic
1011314707 6:86018562-86018584 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1011590896 6:88969777-88969799 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1011608521 6:89128136-89128158 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1011680978 6:89783157-89783179 TCTCTGCAAGAAGAAAAATATGG - Intronic
1011824516 6:91290334-91290356 TCTCTACAAAAAAAAAAAAAAGG + Intergenic
1012138079 6:95584271-95584293 TCTCTGCAAGAAGAAAAATATGG - Intronic
1012272012 6:97225372-97225394 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
1012607155 6:101171413-101171435 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1012704477 6:102503711-102503733 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1012746161 6:103092396-103092418 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1012921350 6:105223772-105223794 TCTCCAGAAAAAAAAAAAAAAGG + Intergenic
1013114144 6:107088006-107088028 TCTCTAAAAAAAAAAAAAAAAGG - Intronic
1013500247 6:110742525-110742547 TCTCTGCAAGAAGAAAAATATGG - Intronic
1013590149 6:111612949-111612971 TCTCTTTCAGAAGCAAAAACTGG + Intergenic
1013616931 6:111851890-111851912 TCTCTTGAAAAAAAAAAAAAGGG - Intronic
1013808342 6:114017479-114017501 TCTCTACTAGAGGAAAAAACTGG + Intergenic
1013875011 6:114814654-114814676 TGTCCAGAAGAATTAAAAACAGG - Intergenic
1013908263 6:115242011-115242033 TTTCTAGAAGTAGAAACATCTGG - Intergenic
1013918662 6:115372406-115372428 TCTTTATAAAAAGAAAAAAAAGG + Intergenic
1013920981 6:115403017-115403039 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1014016610 6:116538089-116538111 TCTCTAGTAGAAAATAAAAATGG - Intronic
1014020492 6:116582796-116582818 GAACTAGAAAAAGAAAAAACTGG - Intronic
1014320755 6:119925274-119925296 TCTCTGAAAGAAGAAAAACATGG + Intergenic
1014366009 6:120542834-120542856 TCTTGAGAAAAAGAAAGAACAGG - Intergenic
1014502889 6:122214548-122214570 CCTGTAGAAAGAGAAAAAACTGG + Intergenic
1014506266 6:122261969-122261991 TCTCTATCAGCAGAAAAAGCTGG - Intergenic
1014551381 6:122792637-122792659 TCTCTAAAAAAAAAAAAAAAAGG - Intronic
1014959458 6:127664611-127664633 TCTACAGAAGAAGGAGAAACAGG + Intergenic
1015235449 6:130965819-130965841 TTGCTAGCAGAAGAATAAACTGG + Intronic
1015536488 6:134272140-134272162 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
1015790630 6:136960802-136960824 ACTCTATTAGAAAAAAAAACAGG + Intergenic
1015820397 6:137254474-137254496 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1016170940 6:141015963-141015985 TCTGTAGTAGGAGAAAAGACTGG - Intergenic
1016396267 6:143626671-143626693 TCTCTATAAGGATAAACAACAGG - Intronic
1016534854 6:145098460-145098482 TCTCTGTAAGAAGAAAAATTTGG + Intergenic
1016606427 6:145934169-145934191 TCTCTACAAAAACATAAAACAGG + Intronic
1016718334 6:147261592-147261614 TTGCTACAAGAAGAAAAACCAGG - Intronic
1017177604 6:151519323-151519345 TCTCTGCAAGAAGAAAAATATGG + Intronic
1017495438 6:154979208-154979230 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
1017573093 6:155769162-155769184 TAGCTAGAATAAGAAAAAAAAGG - Intergenic
1017721704 6:157247610-157247632 TCTCTAGAAAAAAAAAAAGTAGG - Intergenic
1017788007 6:157772414-157772436 TCCCTAGAAGAAAAGAAAATGGG + Intronic
1017850033 6:158297247-158297269 TCTCTGCAAGAAGAAAAATATGG + Intronic
1017850118 6:158298089-158298111 TCTCTGCAAGAAGAAAAATATGG + Intronic
1017855351 6:158346029-158346051 TCTCTTCAAGAAGAAAAATATGG + Intronic
1017868856 6:158469273-158469295 TCTCGAGAAAAAAAAAAAAAAGG - Intronic
1018102183 6:160450338-160450360 TCTCTGCAAGAAGAAAAATATGG + Intronic
1018139867 6:160820690-160820712 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1018300197 6:162393781-162393803 TGTCTCCCAGAAGAAAAAACCGG - Intronic
1019392115 7:794545-794567 TCTCCAGAAAAAAAAAAAAAAGG - Intergenic
1019553385 7:1616037-1616059 TCTCCAGAAAAAAAAAAAAAAGG - Intergenic
1019561093 7:1657968-1657990 TTTCTAGAAAAAAAAAAAAGTGG + Intergenic
1019679259 7:2336099-2336121 TCTCGAGAAAAAAAAAAAAAGGG + Intronic
1020045111 7:5034801-5034823 TCTCAAAAAGAAAAAAAAATGGG + Intronic
1020136130 7:5589023-5589045 TCTCTAAAAAAAAAAAAAATAGG + Intergenic
1020168589 7:5827243-5827265 TCTCTATTAGAAAATAAAACAGG - Intergenic
1020198397 7:6059890-6059912 TCTCAAAAAAAAAAAAAAACGGG + Intergenic
1020243284 7:6411615-6411637 TGTCTCAAAAAAGAAAAAACTGG + Intronic
1020566645 7:9805982-9806004 TCCCTAGAAGAGAAAAAAATTGG - Intergenic
1020707222 7:11560560-11560582 TATCTGGAAGGCGAAAAAACTGG - Intronic
1020757052 7:12215741-12215763 TCTAAAGAAGAAGAATAAGCTGG + Intronic
1020857142 7:13443297-13443319 TTTCAAGAAGAAGAAAATAAAGG - Intergenic
1021497363 7:21290860-21290882 TCTCCACAAAAAGAAAAAAAAGG + Intergenic
1022449265 7:30499401-30499423 TCTCAAAAAGAAAAAAAAAAAGG + Intronic
1023074063 7:36465861-36465883 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1023311409 7:38890685-38890707 TCTCTAAAAGAAAAAAAAAAAGG - Intronic
1023352536 7:39334785-39334807 TCTCTAGAAGAAGAAAAAACAGG - Intronic
1023603886 7:41909576-41909598 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1024801579 7:53086231-53086253 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1024982942 7:55172826-55172848 CTTCTAAAAGGAGAAAAAACAGG - Intronic
1025147409 7:56516618-56516640 TCTCAAGAAAAAAAAAAAAAAGG + Intergenic
1025235234 7:57230112-57230134 TCAGTAGAAGTAGAAAATACGGG + Intergenic
1025743786 7:64225200-64225222 TCTCTGCAAGAAGAAAAATATGG + Intronic
1025755333 7:64332833-64332855 TCTCTGCAAGAAGAAAAATATGG + Intronic
1025819946 7:64953335-64953357 TTTAGAGAAGAATAAAAAACTGG - Intergenic
1025922031 7:65922275-65922297 TCTCAAGAAAAAAAAAAAAAAGG - Intronic
1026728853 7:72893958-72893980 TCTCTTAAAAAAGAGAAAACGGG - Intronic
1027291509 7:76716881-76716903 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1027450229 7:78323053-78323075 TCTATGGAAGAAAAAAAAAAAGG + Intronic
1027552137 7:79612370-79612392 ATTCTAGAAGAAGAAAATCCTGG + Intergenic
1027566572 7:79802024-79802046 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1027674160 7:81139118-81139140 TCTCTTGAAAAAAAAAAAAGAGG - Intergenic
1027775828 7:82463288-82463310 TCTCAAAAAGAAAAAAAAAGGGG + Intergenic
1027859069 7:83552526-83552548 TCTCTGCAAGAAGAAAAATATGG - Intronic
1028053794 7:86218847-86218869 TCTGTACAAAAAGAAATAACAGG - Intergenic
1028073252 7:86478485-86478507 TCCCTTGAAAAACAAAAAACTGG + Intergenic
1028331609 7:89601446-89601468 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1028380809 7:90196566-90196588 TCTCTAAAAAAAGAAAAAGAAGG - Intronic
1028450439 7:90976353-90976375 TCTTTAAAAGAAAAAAAAGCGGG - Intronic
1028584925 7:92443318-92443340 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1028607770 7:92673777-92673799 TCTCAAAAAGAAAAAAAAAAAGG - Intronic
1028806873 7:95038140-95038162 TCGTTAGAACAAGAAAAAACTGG + Intronic
1028896158 7:96044455-96044477 TCTCAAGAAGAAAAAAAAAAAGG - Intronic
1029008518 7:97234195-97234217 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1029099414 7:98116048-98116070 TCTCTACAAAAAGTAAAAATTGG - Intronic
1029190781 7:98770610-98770632 TCTCTAGAAGAAGTAAAAAACGG + Intergenic
1029262276 7:99311291-99311313 TCTCTAGAAAAATAAAAGCCTGG - Intergenic
1029412528 7:100424316-100424338 TCTCTGGAAGAGAAAAAAAATGG + Intronic
1029554001 7:101255056-101255078 TCTCAAGAAGAAGGAGAAGCTGG + Intergenic
1029959545 7:104675224-104675246 TTTCTAAAAGAAGAAACAGCAGG + Intronic
1030003998 7:105097293-105097315 TCTCTACAATTAGAGAAAACAGG - Intronic
1030216496 7:107048394-107048416 TTACTAAAAGAAAAAAAAACAGG - Intronic
1030602369 7:111607229-111607251 TGTCTGGAAGAAGTGAAAACTGG - Intergenic
1030902676 7:115143939-115143961 TTTCTAGAAGATGAAAATGCAGG - Intergenic
1031304535 7:120110125-120110147 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1031347694 7:120689738-120689760 TCTTTAGAAGGAGAAAAAAATGG - Intronic
1031416078 7:121497869-121497891 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1031763061 7:125738129-125738151 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1031978697 7:128110093-128110115 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1031996941 7:128239128-128239150 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1032003321 7:128280787-128280809 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1032004682 7:128291687-128291709 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1032338889 7:131052808-131052830 TCTCAAAAAGAAAAAAAAAAGGG - Intergenic
1032348906 7:131142105-131142127 TCTCTACAAAAACAAAAAAAAGG + Intronic
1033107659 7:138543995-138544017 TCTCTACAAAAAAAAAAATCTGG - Intronic
1033196115 7:139328853-139328875 TCTCAAGAAAAAAAAAAAAAAGG + Intergenic
1033298938 7:140168564-140168586 TCTCAAAAAAAAAAAAAAACTGG + Intronic
1033341259 7:140493995-140494017 TCTCAAAAAAAAAAAAAAACGGG + Intergenic
1033469142 7:141628491-141628513 TCTTTAAAAGAAGAAAAATGTGG - Intronic
1033513610 7:142084805-142084827 TCTCTAGAAGATGGAAACAAGGG - Intronic
1033534915 7:142303374-142303396 TCTCAAAAAGAAAAAAAAAAAGG - Intergenic
1033627409 7:143123661-143123683 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1033675351 7:143535844-143535866 TCCTCAGAAGAAGTAAAAACAGG + Intergenic
1033696486 7:143793594-143793616 TCCTCAGAAGAAGTAAAAACAGG - Intergenic
1033706961 7:143899257-143899279 ACTCTTAAAGAAGAAGAAACAGG + Intronic
1033716788 7:144010618-144010640 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1033903043 7:146166790-146166812 TCTGTAGAAGAAGAAACAGAAGG + Intronic
1034251743 7:149697773-149697795 TCTCTGCAAGAAGAAAAATGTGG - Intergenic
1034395394 7:150820474-150820496 TTTCCAGCAGAAGGAAAAACTGG + Intergenic
1035135309 7:156697638-156697660 TCTCTGCAAGAAGAAAAACATGG + Intronic
1035137925 7:156725657-156725679 TGTCTAGAAGAGAAAACAACAGG - Intronic
1035735532 8:1884392-1884414 TCTCAAGAAAAAAAAAAAAAAGG + Intronic
1035815609 8:2536697-2536719 TCTTAAGAAAAACAAAAAACTGG - Intergenic
1036040798 8:5078700-5078722 TCTCTAGAAGGAAATAAACCTGG + Intergenic
1036219469 8:6909171-6909193 TCTCAAAAAAAAGAAAAAAATGG - Intergenic
1036429851 8:8680059-8680081 TCTCTAGAATAAGAAACACAAGG - Intergenic
1036434119 8:8717111-8717133 TCTCAAAAAGAAAACAAAACAGG + Intergenic
1036535514 8:9646924-9646946 TCTTTAGAAAAAGAAAAATTTGG + Intronic
1036835567 8:12062578-12062600 TCTGGGCAAGAAGAAAAAACAGG - Intergenic
1036857411 8:12309151-12309173 TCTGGGCAAGAAGAAAAAACAGG - Intergenic
1037327062 8:17703173-17703195 TCTCTGCAAGAAGAAAAATATGG - Intronic
1038070576 8:24008387-24008409 TGTCTCGAAGAAAAAAAAAAAGG + Intergenic
1038197226 8:25379419-25379441 TCTCTGCAAGAAGAAAAATGTGG + Intronic
1038344245 8:26717696-26717718 TCTCTAAAAAAAAAAAAAAAAGG - Intergenic
1038434269 8:27523932-27523954 TCTCAAAAAAAAAAAAAAACAGG - Intronic
1039056881 8:33544053-33544075 TCTCAAAAAGAAAAAAAAATTGG - Intergenic
1039072860 8:33662081-33662103 TCTCTAAAAAAAGAAGAAAAAGG - Intergenic
1039183151 8:34888753-34888775 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1039185482 8:34910945-34910967 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1039206681 8:35163605-35163627 TCTCAAAAAGAAAAAAAAAGAGG - Intergenic
1039297375 8:36171015-36171037 TCTTTATCAGAAGAAAAGACAGG + Intergenic
1039331064 8:36537033-36537055 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1039501709 8:38022809-38022831 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1039580359 8:38661244-38661266 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1039598415 8:38811851-38811873 TCTCTGCAAGAAGAAAAATATGG - Intronic
1039690235 8:39856056-39856078 TTTCTAGATAAACAAAAAACTGG + Intergenic
1040411322 8:47157393-47157415 CCTCAACAAGAATAAAAAACTGG + Intergenic
1040426087 8:47287650-47287672 TCTCTGCAAGAAGAAAAATATGG + Intronic
1040499464 8:47994103-47994125 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1040527728 8:48239362-48239384 GCTCTGGAAAAAGAAAAAGCTGG - Intergenic
1040868552 8:52076390-52076412 TCTGAACAAGAAGAAAGAACTGG + Intergenic
1040926371 8:52688262-52688284 TCTCTACAAGAAGAAAAATATGG - Intronic
1041105852 8:54443454-54443476 TCACTAGAAGAATAAAATAAAGG - Intergenic
1041191453 8:55359580-55359602 TCTCTAGAGGGAGAAAATCCAGG + Intronic
1041260616 8:56018127-56018149 TCTCTAGAAAAATAAAAATAAGG - Intergenic
1041728536 8:61041882-61041904 TCTCTCAAAAAACAAAAAACAGG - Intergenic
1041823940 8:62069885-62069907 TATCAAGAAGAAGAAAGAACTGG + Intergenic
1041860163 8:62503732-62503754 TCTCTGCAAGAAGAAAAATATGG + Intronic
1041907712 8:63052049-63052071 TCTCTGCAAGAAGAAAAATATGG - Intronic
1041942174 8:63400631-63400653 TCTCAAGAAGAAAACAACACGGG + Intergenic
1042128768 8:65565641-65565663 TCTCAAAAAGAAAAAAAAAAGGG + Intergenic
1042191418 8:66191316-66191338 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1042428898 8:68681041-68681063 TCTCTGCAAGAAGAAAAATATGG + Intronic
1042551431 8:69997174-69997196 TCTCTTAAAAAAGAAAAAAGTGG - Intergenic
1042561644 8:70076332-70076354 TGTCTGGAAGAAGAAAAAAATGG - Intergenic
1042758826 8:72249562-72249584 TCTCTAGAAAATGAAACCACAGG + Intergenic
1042834725 8:73069284-73069306 TCTCCAGAAGAAAAAAAAAAAGG - Intronic
1042934082 8:74041473-74041495 TCTCTCCAAGAAGAAAAATATGG - Intergenic
1043144982 8:76641813-76641835 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1043144989 8:76641861-76641883 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1043281328 8:78470644-78470666 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1043500184 8:80846125-80846147 TCTCTACAAAATCAAAAAACTGG - Intronic
1043732095 8:83695396-83695418 TCTCAAAAAAAAAAAAAAACAGG - Intergenic
1043750772 8:83931094-83931116 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1044064760 8:87685822-87685844 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1044288899 8:90444374-90444396 TCTCAAAAAAAAAAAAAAACGGG + Intergenic
1044318659 8:90777692-90777714 TCTCTGCAAGAAGAAAAATACGG + Intronic
1044574250 8:93751091-93751113 TGTCCAGAAGAAAAAAAAAACGG + Intergenic
1044740817 8:95324254-95324276 TCTCTGGATGAAGAATATACGGG - Intergenic
1045117556 8:99000272-99000294 TCTGTAGAAAAAGCAAAAGCAGG + Intergenic
1045698533 8:104838981-104839003 GTTCTAGAAGAAAATAAAACAGG + Intronic
1046253593 8:111666486-111666508 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1046494537 8:114996677-114996699 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1046570064 8:115952096-115952118 TTTCCAGAAAAAAAAAAAACTGG - Intergenic
1046922954 8:119753222-119753244 TCTTGAGAAGAAAAATAAACTGG - Intronic
1046979483 8:120321328-120321350 TCTCTAGAGTCAGTAAAAACAGG - Intronic
1047099512 8:121660896-121660918 TCTCAGAAAGAAAAAAAAACTGG - Intergenic
1047368675 8:124236606-124236628 TCTCAAGAAAAAAAAAAAAATGG + Intergenic
1047922291 8:129647625-129647647 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1048033816 8:130657839-130657861 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1048602192 8:135930261-135930283 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1049550856 8:143258706-143258728 TCTCTAGAAAAAAGAAAAATGGG + Intronic
1049828039 8:144683013-144683035 TCTCAAAAACAAGCAAAAACTGG + Intergenic
1049870914 8:144975199-144975221 TCTCTAGAAGAAGTTGTAACTGG + Intergenic
1050394462 9:5180407-5180429 TCTCTGCAAGAAGAAAAATATGG - Intronic
1050586540 9:7118150-7118172 TCTGTAGAAGCACAAACAACAGG - Intergenic
1050945192 9:11509260-11509282 CCTCTATAAGAAAAATAAACTGG + Intergenic
1051197106 9:14574217-14574239 TTTCTGGAAGATGAAAGAACTGG + Intergenic
1051227310 9:14914139-14914161 TATCTAAAAGAATAAAAACCAGG + Intergenic
1051562890 9:18462636-18462658 TCAGTAGAAGAAGGAAAAAGGGG + Intergenic
1051658261 9:19403266-19403288 TCTCTGGAAGAAGAAAAATATGG - Intergenic
1052065118 9:24009162-24009184 TCCCTAGCAGGAGTAAAAACTGG - Intergenic
1052161985 9:25273883-25273905 TCTCCAGAAAAAGAAAACATAGG - Intergenic
1052281979 9:26743355-26743377 TCTCAACAAGAAGAAAAAGAAGG - Intergenic
1052452480 9:28649909-28649931 TCTGTAGAATAACACAAAACTGG - Intronic
1052687119 9:31770992-31771014 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1052769310 9:32672894-32672916 TCTCTAGAACAAGAGAAAGAAGG + Intergenic
1052958055 9:34270214-34270236 TCTCAAGAAAAAAAAAAAATTGG + Intronic
1053223721 9:36333320-36333342 TCTCAAAAAAAAGAAAAAGCCGG - Intergenic
1053702457 9:40709550-40709572 AATATAGAAAAAGAAAAAACTGG - Intergenic
1053755551 9:41303101-41303123 TCTCAAGAAAAAAAAAAAAAAGG - Intergenic
1053796961 9:41735331-41735353 TCTCAAGAAAAAAAAAAAAAGGG - Intergenic
1054359514 9:64100193-64100215 TCTGTAGAAGAAGGAAGAACAGG + Intergenic
1054412516 9:64833013-64833035 AATATAGAAAAAGAAAAAACTGG - Intergenic
1055451102 9:76432105-76432127 TCTCAAGAAAAGGAAAAAAAAGG + Intronic
1055451447 9:76434712-76434734 TCTCTGCAAGAAGAAAAATATGG - Intronic
1055622588 9:78142063-78142085 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1055936239 9:81607056-81607078 TCTCTAAAAAAAAAAAAAAATGG + Intronic
1056023998 9:82473138-82473160 AATCTTGAAGAAGAACAAACTGG + Intergenic
1056052127 9:82779859-82779881 TGTCTAGAAGAAGAAGAGACAGG - Intergenic
1056078832 9:83068798-83068820 TTTCTTAAAGAAGAAAAAAACGG + Intergenic
1056430532 9:86523618-86523640 TCTTTACAAGAAGAAAAAGTTGG - Intergenic
1056603356 9:88064174-88064196 TCTCCAGATGAAGAAACAAAAGG + Intergenic
1056664271 9:88568686-88568708 TCTGCAAAAGAAGAGAAAACAGG - Intronic
1056732634 9:89178828-89178850 CCTGTAGCAGAAGAAAAAAAAGG + Intergenic
1057100671 9:92356342-92356364 TCTCTGCAAGAAGAAAAATATGG + Intronic
1057242594 9:93424682-93424704 TATCTAGAAGACGAAATTACCGG + Intergenic
1057788066 9:98103247-98103269 TCTCCAGAAAAAAAAAAAACAGG + Intronic
1058143686 9:101385532-101385554 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1058197202 9:101992230-101992252 CCTCTAGAAGTAGAAAAAGGAGG + Intergenic
1058225431 9:102356031-102356053 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1058252184 9:102712978-102713000 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1058459585 9:105170538-105170560 TCTCAAAAAGAAAAAAAAAAAGG + Intergenic
1058533737 9:105933379-105933401 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1058691952 9:107527612-107527634 TCTCAAAAAAAAGAAAAAAACGG - Intergenic
1059023840 9:110603761-110603783 TCTCAAGAAAAAAAAAAAAAAGG - Intergenic
1059198126 9:112390157-112390179 ACTCTTGAAGAAGAATAAATTGG + Intronic
1059198418 9:112392616-112392638 TCTCTGCAAGAAGAAAAATATGG + Intronic
1059199347 9:112399731-112399753 TCTCTGCAAGAAGAAAAATATGG + Intronic
1059322138 9:113478081-113478103 TTTTTAAAAAAAGAAAAAACAGG - Intronic
1059523197 9:114963187-114963209 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1059580929 9:115547446-115547468 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1059737661 9:117118356-117118378 CCTCTAGGAGAGGAAAAAAAGGG - Intronic
1059840244 9:118207005-118207027 TCTCAAGAAGAAGAAAAACAAGG + Intergenic
1059869198 9:118552462-118552484 TTTATAGAAGAAGAATAAACTGG - Intergenic
1060176952 9:121504066-121504088 TCTCAAGAAAAAAAAAAAAAAGG - Intergenic
1060760497 9:126243901-126243923 TTTCTGGAAAAAAAAAAAACTGG + Intergenic
1060767070 9:126302831-126302853 TTTCCATAAGAATAAAAAACTGG + Intergenic
1060836364 9:126758012-126758034 TGTCTCAAAGAAGAAAAAAAGGG - Intergenic
1060986361 9:127821427-127821449 TCTCTAAAACAAGAAAAAGAAGG + Intronic
1061094520 9:128447584-128447606 TCTCAAAAAGAAAAAAAAATTGG + Intergenic
1061151101 9:128828810-128828832 TCTCAAGCTGATGAAAAAACTGG - Exonic
1061166222 9:128923815-128923837 TCTCTAAAAAAAAATAAAACTGG + Intronic
1061839094 9:133347512-133347534 TCTCCAAAAGAAAAAAAAAAGGG + Exonic
1062486570 9:136779421-136779443 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1062552248 9:137094570-137094592 TCTCTATTAAAAAAAAAAACAGG + Intronic
1203517753 Un_GL000213v1:18920-18942 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1203694731 Un_GL000214v1:87441-87463 TCTGTAGAAGAAGGAAGAACAGG - Intergenic
1203704820 Un_KI270742v1:29991-30013 TCTGTAGAAGAAGGAGGAACAGG + Intergenic
1203559185 Un_KI270744v1:35820-35842 TCTGTAGAAGAAGGAAGAACAGG - Intergenic
1203641542 Un_KI270751v1:16622-16644 TCTGTAGAAGAAGGAAGAACAGG + Intergenic
1185842100 X:3401410-3401432 TCTCAAGAAAAAAAAAAAAAGGG - Intergenic
1185848621 X:3464525-3464547 TCTCAAGAAAAAAAAAAAAGTGG - Intergenic
1185929512 X:4186674-4186696 TCTCAAGAAGAAGAAAAATCAGG + Intergenic
1185966720 X:4614113-4614135 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1186283483 X:8019215-8019237 TATCAAGAAGGAGAGAAAACAGG - Intergenic
1186600093 X:11027674-11027696 TCTCAGGGAGAAAAAAAAACAGG - Intergenic
1186857181 X:13637573-13637595 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1187269379 X:17765844-17765866 TCGCTAGAAAAAGAAAGAAATGG - Intergenic
1187552405 X:20319090-20319112 TGTCTAGAAGCAGAAGAAAGAGG + Intergenic
1187625002 X:21101491-21101513 ACTCTATAAGAAAAAAAATCTGG + Intergenic
1187685156 X:21808590-21808612 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1187715638 X:22099646-22099668 TCTTTAAAATAAGAAAAACCTGG - Intronic
1187857913 X:23654855-23654877 TCTCAAAAAAAAAAAAAAACAGG + Intergenic
1187924026 X:24234138-24234160 TCTCAAAAAAAAAAAAAAACTGG - Intergenic
1188105893 X:26146192-26146214 TCTGTCTAAGAAGAAAAAAATGG + Intergenic
1188125137 X:26358086-26358108 TCTCTAGAAGAACAAAAGGCTGG - Intergenic
1188638012 X:32460080-32460102 TTTCCAAAAGAAGAAAAAAATGG + Intronic
1188669205 X:32862746-32862768 TCTCAACAACAACAAAAAACTGG - Intronic
1190197970 X:48336053-48336075 TCTCAAAAAGAAAAAAAAATTGG - Intergenic
1190253625 X:48746460-48746482 TCTCTAGAAAGAAAAAAAAAAGG - Intergenic
1190414500 X:50167527-50167549 TGTCTAGGAGAAGATAAATCTGG + Intergenic
1190664717 X:52686487-52686509 TCTCAAAAAGAAAAAAAAATTGG - Intronic
1190674705 X:52771931-52771953 TCTCAAAAAGAAAAAAAAATTGG + Intronic
1190718798 X:53129387-53129409 TTTCAAGAAGAAGAAAAATCAGG - Intergenic
1190727529 X:53199385-53199407 TTTATAGAGGAAGAAAAATCAGG + Intronic
1191147516 X:57183838-57183860 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1191832035 X:65426087-65426109 TATCAAGAAAAAAAAAAAACAGG - Intronic
1191887275 X:65901633-65901655 TTACTACAAGGAGAAAAAACAGG + Intergenic
1191896224 X:65996162-65996184 TCTTTATAACAAGAAAAAATTGG - Intergenic
1192295562 X:69844077-69844099 TCCCTTGAAGAAGAAAAAAGGGG + Intronic
1192346040 X:70306839-70306861 TCTCTAAAAAAAAAAAAAAGAGG - Intronic
1192484108 X:71510331-71510353 TCCCTAGTAGAAAAAAAAAAAGG + Intronic
1192675613 X:73192726-73192748 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1192921110 X:75707469-75707491 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1193053849 X:77128689-77128711 TTTCAAAAAGAAGAAAAAAGTGG + Intergenic
1193224757 X:78969266-78969288 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1193300761 X:79885992-79886014 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1193411528 X:81169063-81169085 TTTCTAGAAGAAACAAAACCTGG + Intronic
1193623179 X:83782730-83782752 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1193630403 X:83879263-83879285 CCTCTAGAAGATGAGAAAATAGG - Intronic
1193691946 X:84657101-84657123 CCTCTAGAAGAGAGAAAAACAGG - Intergenic
1193708397 X:84851213-84851235 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1193857999 X:86629023-86629045 TCTCTATAAGTAGAATAAATGGG - Intronic
1193872985 X:86824314-86824336 TCTCTGCAAGAAGAAAAATATGG + Intronic
1193980315 X:88174507-88174529 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1194042241 X:88956121-88956143 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1194267190 X:91769145-91769167 CCTCTGGAAGAATAAAAGACAGG + Intergenic
1194287920 X:92033371-92033393 TTTCTAGAAAAAAAAAAAAAAGG - Intronic
1194440665 X:93929455-93929477 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1194462411 X:94188221-94188243 TCTCAAGGAAAAAAAAAAACTGG - Intergenic
1194545864 X:95232658-95232680 TTCCTAGAGGAAGAAAAACCTGG - Intergenic
1194579483 X:95654360-95654382 TCACTAGACCAAGAAGAAACTGG + Intergenic
1195377010 X:104237833-104237855 TCTCTCAAAAAACAAAAAACAGG - Intergenic
1195395924 X:104410388-104410410 TCTCTAGAAGTAATCAAAACTGG + Intergenic
1195981411 X:110582293-110582315 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1195999341 X:110764678-110764700 TCTCTGCAAGAAGAAAAATATGG - Intronic
1196423824 X:115549754-115549776 TTTCTAAAAAAAAAAAAAACTGG + Intergenic
1196597850 X:117565623-117565645 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1196637045 X:118014161-118014183 TCTCTGCAAGAAGAAAAATATGG - Intronic
1196944221 X:120808275-120808297 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1197000742 X:121436370-121436392 TAAGAAGAAGAAGAAAAAACTGG + Intergenic
1197041354 X:121939698-121939720 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1197070568 X:122291872-122291894 TCTATTGAAGAAGAAGAAATTGG - Intergenic
1197520677 X:127492327-127492349 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1197628594 X:128832086-128832108 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1197637580 X:128932372-128932394 ACTCTGGAAGAAGAAAGAAGAGG - Intergenic
1197817485 X:130513059-130513081 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1197947512 X:131856347-131856369 TCTATAGAAAAAGAAAATTCTGG - Intergenic
1198006710 X:132502167-132502189 TCTTTTGAAGAAAAAAAAAATGG + Intergenic
1198327835 X:135591850-135591872 TCTCTATACGAAGAAAGAACAGG + Intergenic
1198386981 X:136138331-136138353 TCTTTAGAAAAAGAAAAAAAAGG - Intergenic
1198483615 X:137064241-137064263 TCTCTACAAAACGAAAAAATTGG + Intergenic
1198556493 X:137798901-137798923 TCTCTGAAAGAAGAAAAATATGG + Intergenic
1198857336 X:141032270-141032292 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1198905359 X:141555096-141555118 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1198996466 X:142579023-142579045 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1199194292 X:145008809-145008831 TCTCTATAAGTAGGAAAAAAAGG - Intergenic
1199259511 X:145755115-145755137 TCTCTGGAAGAAGCATACACAGG - Intergenic
1199523367 X:148763466-148763488 TCTCTAAAAAAAAAAAAATCAGG - Intronic
1199542889 X:148977227-148977249 TGGCTAGAAGAAAAAAAAATGGG + Intronic
1199989384 X:152976935-152976957 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1200021315 X:153212163-153212185 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1200203488 X:154298690-154298712 TCTCAAAAAGAAAAAAAAATTGG + Intronic
1200321570 X:155195537-155195559 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1200372359 X:155740369-155740391 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1200393150 X:155964557-155964579 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1200584394 Y:4990084-4990106 CCTCTGGAAGAATAAAAGACAGG + Intergenic
1200605447 Y:5257926-5257948 TTTCTAGAAAAAAAAAAAAAAGG - Intronic
1200613586 Y:5353001-5353023 TCTCCAGAAAAAAAAAAAAAAGG - Intronic
1201187454 Y:11417930-11417952 TCTCAAGAAAAAAAAAAATCAGG - Intergenic
1201291929 Y:12428595-12428617 TCTCTAAAAGAGAAAAAAATAGG - Intergenic
1201441205 Y:14010342-14010364 TATCAAGAAGGAGAGAAAACAGG - Intergenic
1201443366 Y:14032366-14032388 TATCAAGAAGGAGAGAAAACAGG + Intergenic
1201475997 Y:14381070-14381092 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1201616774 Y:15909139-15909161 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1201708757 Y:16966455-16966477 CCTCAAGAAGAAGAAAAATCAGG + Intergenic
1201860415 Y:18591736-18591758 TCTCTGCAAGAAGAAAAATATGG - Intergenic
1201872908 Y:18728645-18728667 TCTCTGCAAGAAGAAAAATATGG + Intergenic
1202582011 Y:26392044-26392066 TCTCTTCAAGAAGAGAAAACAGG + Intergenic