ID: 1023352542

View in Genome Browser
Species Human (GRCh38)
Location 7:39334831-39334853
Sequence CAATAAATACAGAGTTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023352536_1023352542 23 Left 1023352536 7:39334785-39334807 CCTGTTTTTTCTTCTTCTAGAGA 0: 1
1: 0
2: 7
3: 119
4: 1432
Right 1023352542 7:39334831-39334853 CAATAAATACAGAGTTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023352542 Original CRISPR CAATAAATACAGAGTTAGGG AGG Intronic
No off target data available for this crispr