ID: 1023352542 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:39334831-39334853 |
| Sequence | CAATAAATACAGAGTTAGGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1023352536_1023352542 | 23 | Left | 1023352536 | 7:39334785-39334807 | CCTGTTTTTTCTTCTTCTAGAGA | 0: 1 1: 0 2: 7 3: 119 4: 1432 |
||
| Right | 1023352542 | 7:39334831-39334853 | CAATAAATACAGAGTTAGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1023352542 | Original CRISPR | CAATAAATACAGAGTTAGGG AGG | Intronic | ||
| No off target data available for this crispr | |||||