ID: 1023353679

View in Genome Browser
Species Human (GRCh38)
Location 7:39345707-39345729
Sequence TGGAAGAATCCACATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023353673_1023353679 3 Left 1023353673 7:39345681-39345703 CCGAGTTCTGAGGACCTTTGGAA 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1023353679 7:39345707-39345729 TGGAAGAATCCACATGGGGTAGG 0: 1
1: 0
2: 1
3: 27
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023353679 Original CRISPR TGGAAGAATCCACATGGGGT AGG Intronic
900885233 1:5410400-5410422 TGGAGGAAGCCACATGGGCTGGG + Intergenic
901664656 1:10819497-10819519 TGGTAGAAGCCCCATTGGGTGGG + Intergenic
902847944 1:19127055-19127077 TGGAAGACTCTACAGGGGGTGGG - Intronic
906562340 1:46768443-46768465 TGGAAGATGCCAAATGGGGTGGG + Intronic
907322935 1:53617006-53617028 TGCATGAAGCCCCATGGGGTGGG - Intronic
908627241 1:66058612-66058634 TGGTAGCTTCCACATGGTGTTGG - Intronic
908768342 1:67573692-67573714 TGAAAGAAGCCACATGCTGTGGG + Intergenic
910055831 1:83032189-83032211 TGGCAGCTTCCACATGGTGTTGG + Intergenic
910512910 1:88025891-88025913 TGGCAGCTTCCACATGGTGTTGG - Intergenic
910746897 1:90583871-90583893 GGGAAGGAGCCCCATGGGGTAGG - Intergenic
911741091 1:101387326-101387348 TGGCAGCTTCCACATGGTGTTGG - Intergenic
913490659 1:119376733-119376755 TGGCAGCTTCCACATGGTGTTGG - Intronic
914815740 1:151060620-151060642 TGAAAGACCCCACATGAGGTGGG + Intronic
916688889 1:167172208-167172230 TGGCAGCTTCCACATGGTGTTGG + Intergenic
917345326 1:174022750-174022772 TGGAAGAAGAAAAATGGGGTGGG - Intergenic
918167620 1:181965427-181965449 TGGCAGCATCCACGTGGTGTTGG - Intergenic
919366620 1:196669586-196669608 TGGCAGCTTCCACATGGTGTTGG + Intronic
921280914 1:213567387-213567409 TGTAAGTGTCCACATGGAGTCGG - Intergenic
921531248 1:216285356-216285378 TGGCAGCTTCCACATGGTGTTGG + Intronic
922507338 1:226134170-226134192 TGGGAGAAGACACATGGGGAAGG - Intergenic
922688282 1:227665043-227665065 TGGTATAATCCCCATTGGGTAGG - Intronic
923088746 1:230722200-230722222 TGGCAGCTTCCACATGGTGTTGG + Intergenic
924872131 1:248059747-248059769 TGGCAGAATAAACATGGGTTGGG + Intronic
1062859244 10:797183-797205 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1065351259 10:24797559-24797581 TGGAAGAATCAGCCTAGGGTTGG - Intergenic
1067573262 10:47386921-47386943 TGGAAGCTTGCACATGGTGTTGG - Intergenic
1068799150 10:61119944-61119966 TAGAAAAATCCAAATGTGGTAGG - Intergenic
1068805775 10:61192611-61192633 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1072240437 10:93490517-93490539 TGGAAGAGTTCACATGGGGCTGG + Intergenic
1074312872 10:112337488-112337510 AAGAAGATTCCACATGGGTTGGG + Intergenic
1076267387 10:129119346-129119368 AGGCAGAAGCCACATGGGGGTGG + Intergenic
1076434947 10:130434317-130434339 TGGAAGAATCCACAAAGTGCTGG - Intergenic
1076590095 10:131576983-131577005 TGGAAGAATGGACGAGGGGTGGG - Intergenic
1078528432 11:12118373-12118395 TGGAAGGATCCACAGGGGGCTGG - Intronic
1078989862 11:16635847-16635869 TGGAAGCTTCCACATGGTGTTGG + Intronic
1079916193 11:26371260-26371282 TGGCAGCTGCCACATGGGGTTGG + Intronic
1080242599 11:30143842-30143864 TGGCAATATCCACATGCGGTAGG - Intergenic
1080707668 11:34713307-34713329 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1082085554 11:48046730-48046752 TGTAATAATCCACATAGGGTAGG - Intronic
1089075826 11:115737703-115737725 TGGAAGAGTCCACAAGGTCTGGG - Intergenic
1090823888 11:130369718-130369740 GGGAAGAATCCAAATGGAATTGG - Intergenic
1092595482 12:9999684-9999706 TTGAAGGATCCACATGAGGCAGG + Intronic
1093351009 12:18103280-18103302 TGGGAGATTCCACATAGTGTTGG - Intronic
1093829105 12:23733843-23733865 TGGATGATGTCACATGGGGTTGG + Intronic
1095794164 12:46198959-46198981 TGGAAGAAGCTACATGGAGTGGG + Intronic
1095833747 12:46615097-46615119 GGGAGGAATGCACATGGGGGTGG + Intergenic
1097015535 12:55984033-55984055 AGCAAGACTCCACCTGGGGTGGG - Intronic
1097443970 12:59646407-59646429 TGGAAGCTTCCACATGGTGTTGG + Intronic
1097881260 12:64688662-64688684 TGGAAGCATCCATATGTGATTGG + Intronic
1098741578 12:74179262-74179284 TGGCAGATTCCACATGGTGTTGG - Intergenic
1099669716 12:85674382-85674404 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1099944796 12:89232380-89232402 TGGAGGAATTCACATGGGAAAGG - Intergenic
1100348335 12:93754116-93754138 TGGCAGTTTCCACATGGTGTTGG - Intronic
1100922787 12:99507907-99507929 TGGAAAGATGAACATGGGGTGGG - Intronic
1102356382 12:112240003-112240025 TTGAAGAACTCACATGTGGTGGG - Exonic
1103161396 12:118732287-118732309 TTTAAGAATCCACATGTGCTTGG + Intergenic
1103462629 12:121117230-121117252 CGGAACAAACCACATGAGGTTGG + Intergenic
1104742059 12:131184908-131184930 TGGCAGCTTCCACATGGAGTTGG - Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106665627 13:31847377-31847399 TGGAAGAATCCCCCTTGGGGAGG + Intergenic
1108068877 13:46607036-46607058 TGGAGGAATCAGCTTGGGGTTGG + Intronic
1110022307 13:70490666-70490688 TGGTAGCTTCCACATGGTGTTGG + Intergenic
1110156349 13:72321516-72321538 TGGAACACTGCACATGTGGTAGG + Intergenic
1111376669 13:87388357-87388379 TGGATTAATCCACATTTGGTTGG + Intergenic
1112440485 13:99421378-99421400 TGGGCGAATCCACATGAGTTTGG - Intergenic
1112685115 13:101815732-101815754 AGGAGAAATCTACATGGGGTGGG - Intronic
1112727118 13:102317732-102317754 TGGTAGAAGCCAGAAGGGGTGGG - Intronic
1113457823 13:110461476-110461498 TGGAAGTAGCCACAGGTGGTTGG - Intronic
1114693472 14:24606529-24606551 GGCAAGAATCCCCAAGGGGTGGG - Exonic
1116420081 14:44722371-44722393 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1116742662 14:48776514-48776536 TGGCAGCTTCCACATGGGGTAGG + Intergenic
1116998296 14:51346975-51346997 TGGAAGCTTCCACATGGTGTTGG + Intergenic
1117444053 14:55786955-55786977 TGGAAGAAGACCCGTGGGGTGGG - Intergenic
1118431909 14:65727424-65727446 TGGCAGCTTCCACATGGTGTTGG - Intronic
1118471547 14:66079431-66079453 TGGAAGAATCCTCAGGGGTAGGG + Intergenic
1118957020 14:70491659-70491681 TGGCAGTTTCCACATGGTGTTGG - Intergenic
1118963900 14:70561765-70561787 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1120103973 14:80473724-80473746 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1120140634 14:80926389-80926411 CAGAAGAATCCACAAGGGGAAGG - Intronic
1120481428 14:85054199-85054221 TGGTAGCTTCCACATGGTGTTGG - Intergenic
1120808935 14:88782697-88782719 TGGCAGCTTCCACATGGTGTTGG + Intronic
1120818096 14:88884148-88884170 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1121026651 14:90621151-90621173 AGGCAGAAGCCACATGGGTTCGG + Intronic
1121237946 14:92406595-92406617 TGGCAGCTTCCACATGGTGTTGG - Intronic
1121744144 14:96274843-96274865 TGGAAGAAGCCACAAGGCATTGG - Intergenic
1122455916 14:101851133-101851155 TGGAAGAATACACTTGGGGCTGG + Intronic
1124341248 15:28890437-28890459 TGGAAAGATCCAGATGGAGTGGG - Intronic
1124982485 15:34579368-34579390 TGGAAAGATCCAGATGGAGTGGG + Intronic
1126343660 15:47670504-47670526 GGGGAGAATGCACATGGGGAAGG + Intronic
1126942829 15:53784872-53784894 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1129066820 15:72912093-72912115 AGGCAGAACCCAGATGGGGTGGG - Intergenic
1130324163 15:82865786-82865808 TGGCAGCTTCCACATGGCGTTGG + Intronic
1131152780 15:90057314-90057336 AGGAAGAAGGCACCTGGGGTGGG + Intronic
1131152946 15:90058245-90058267 AGGAAGAAGGCACTTGGGGTGGG + Intronic
1131285379 15:91052579-91052601 TGGAAGAACAGAGATGGGGTGGG - Intergenic
1133043093 16:3071011-3071033 TGGCAGCTTCCACATGGTGTTGG - Intronic
1133185092 16:4090183-4090205 TGGAAGTATCCATAGGGCGTGGG - Intronic
1134020298 16:10916684-10916706 TGGATGAATCCACTGGGGCTGGG - Intronic
1135527856 16:23227768-23227790 TCGGGGAATCCACATGGTGTGGG - Intergenic
1139378939 16:66518112-66518134 TGGGAGAATTCACTTGGGATTGG + Intronic
1141784455 16:86189358-86189380 TGGAAGAGGGAACATGGGGTGGG - Intergenic
1143851635 17:9817265-9817287 AGGAAAAATCCGCATGGGCTGGG - Intronic
1144311130 17:14015302-14015324 AAGAAGAAGCCTCATGGGGTCGG + Intergenic
1146451948 17:32981634-32981656 TGGCAGCTTCCACATGGTGTTGG - Intronic
1147178536 17:38671458-38671480 AGGAAGAAGACACAAGGGGTGGG - Intergenic
1149336151 17:55638350-55638372 TTGAAGAATCCAGATGGTCTTGG - Intergenic
1152895180 17:82906894-82906916 TGGAAGAAGGCACATGGGGTGGG + Intronic
1153098920 18:1441670-1441692 TAAAAGATTCCACATGGGGCAGG + Intergenic
1153262886 18:3241434-3241456 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1153449923 18:5215743-5215765 AGGAAGAATCCAGATGTGGGAGG - Intergenic
1153506353 18:5803447-5803469 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1155951321 18:31916328-31916350 TGGTATAAACCACTTGGGGTAGG + Exonic
1158223004 18:55169336-55169358 TGGTAGCTTCCACATGGTGTTGG + Intergenic
1158601793 18:58862902-58862924 TGGAAGACACCCCCTGGGGTGGG - Exonic
1166438092 19:42786517-42786539 TGGCACAATCTACATGTGGTGGG - Intronic
1166457048 19:42950311-42950333 TGGCACAATCTACATGTGGTGGG - Intronic
1166466993 19:43041170-43041192 TGGCACAATCTACATGTGGTGGG - Intronic
1166486796 19:43220795-43220817 TGGCACAATCTACATGTGGTGGG - Intronic
1166493908 19:43284242-43284264 TGGCACAATCTACATGTGGTGGG - Intergenic
925453354 2:3990726-3990748 TGGAGGCTTCCACATGGTGTTGG - Intergenic
926375527 2:12223810-12223832 TGGCAGCATCCACGTGGTGTTGG + Intergenic
926391949 2:12402811-12402833 TGGCAGCTTCCACATGGTGTTGG + Intergenic
928425435 2:31174107-31174129 TGGCAGAGTCCAGGTGGGGTGGG - Intronic
928749894 2:34459039-34459061 TGGCAGCTTCCACATGGTGTTGG + Intergenic
928860053 2:35846479-35846501 TAGAAGAATCCACCTGGAGGTGG - Intergenic
929052442 2:37849588-37849610 TAGAAGAAACCAAAAGGGGTGGG - Intergenic
929748487 2:44684683-44684705 TGGAAGAATCCACATTCAATAGG - Intronic
930404849 2:50942133-50942155 TGGCAGCTTCCACATGGTGTTGG + Intronic
931041430 2:58305192-58305214 TGGCAGCTTCCACATGGTGTTGG + Intergenic
932707565 2:74038431-74038453 GGGAAGAAACCTGATGGGGTTGG + Intronic
932923297 2:75941934-75941956 TGGCAGCTTCCACATGGTGTTGG + Intergenic
933978000 2:87527476-87527498 TGTGAGGATCCACATGGGCTGGG + Intergenic
935655106 2:105415324-105415346 TGGAAGGATGCACAAGGAGTTGG + Intronic
936315832 2:111423331-111423353 TGTGAGGATCCACATGGGCTGGG - Intergenic
936728948 2:115357845-115357867 TGGAAGCTTCCACATGGTGTTGG - Intronic
936818732 2:116492191-116492213 TGGAAGAATACACTTGTTGTCGG + Intergenic
937561006 2:123223821-123223843 TGGCAGCTTCCACATGGTGTTGG - Intergenic
938263181 2:129909584-129909606 TGGGAGGACCCTCATGGGGTGGG - Intergenic
941506820 2:166356638-166356660 TGGATGGATACACAAGGGGTTGG - Intronic
941525192 2:166598076-166598098 TGGCAGCTTCCACATGTGGTTGG - Intergenic
944364538 2:198902124-198902146 TGGAAGTGTCCACAAGGAGTGGG + Intergenic
944737012 2:202576186-202576208 TGGAATAATAGACATTGGGTGGG - Intergenic
945673250 2:212827242-212827264 TGGAAGAATGCATATGGGATTGG + Intergenic
947120799 2:226812578-226812600 TGGAACAATCCCCATGGTGGGGG + Intergenic
1170337098 20:15281998-15282020 TGGAAGCTTACACATGGTGTTGG - Intronic
1170741817 20:19065130-19065152 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1174332190 20:49829221-49829243 TTGAAGAAACCTCATGGGGCTGG + Intronic
1177317176 21:19477234-19477256 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1179232640 21:39519145-39519167 TGGAAGATTCCAGTTGGGGAGGG + Intergenic
1180152956 21:45961441-45961463 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1180685696 22:17664744-17664766 TGGCAGCTTCCACATGGTGTTGG - Intronic
1182016570 22:27045236-27045258 GAGAAGAATCAACATGGGGCTGG + Intergenic
1183034487 22:35130939-35130961 GGGAAGAATCCAAATAGGGGTGG + Intergenic
1183447256 22:37865987-37866009 AGGTAGATGCCACATGGGGTAGG + Intronic
1183650650 22:39151760-39151782 TTGAAGAAGGCAGATGGGGTAGG + Intronic
1184108976 22:42384186-42384208 TGGATGAAGCCACAGGTGGTGGG + Exonic
1184338872 22:43874504-43874526 TGGCAGCTTCCACATGGTGTTGG + Intergenic
950424129 3:12915489-12915511 TGGAAGAGACCACACGGAGTGGG + Intronic
950638063 3:14330110-14330132 TGAAAGAATCCATCTGGGCTGGG - Intergenic
951037658 3:17951516-17951538 TGGCAGCTTCCACATGGTGTTGG + Intronic
951385004 3:22031438-22031460 TGGAGGCTTCCACATGGTGTTGG - Intronic
952866039 3:37855754-37855776 TGGAAGAATCCATGTGTGATGGG + Intergenic
952939716 3:38433140-38433162 TGGCAGCTTCCACATGGTGTTGG - Intergenic
954007713 3:47605473-47605495 TGGAAGAAGCCAGATGTGGCCGG + Intronic
955196913 3:56812980-56813002 AGGAGGAATCCACATGATGTTGG - Intronic
956149439 3:66225326-66225348 TGGCAGCTTCCACATGGTGTTGG - Intronic
956999694 3:74871431-74871453 TGGAAGAAGCGAGATGGGTTTGG + Intergenic
957471824 3:80668417-80668439 TGGCAGCTTCCACATGGTGTTGG + Intergenic
957920920 3:86747864-86747886 TGGCAGCTTCCACATGGTGTTGG + Intergenic
959214803 3:103437719-103437741 TGGCAGCTTCCACATGGTGTTGG - Intergenic
963494848 3:146045746-146045768 TGGCAGCTTCCACATGGTGTTGG - Intergenic
963668326 3:148218616-148218638 TGGGAGTATCCACAGGGGGTGGG + Intergenic
963836237 3:150060621-150060643 TGGGAGAACCCACAGAGGGTAGG + Intergenic
965404874 3:168255945-168255967 TGGAAGCTTCCACATGGTGTTGG - Intergenic
966463419 3:180202970-180202992 TGGAAGCAGCCACGTGGTGTGGG + Intergenic
967519865 3:190416764-190416786 TGGCAGCTTCCACATGGTGTTGG - Intergenic
967582735 3:191179161-191179183 TGGTAGATTCCACATGGTGTTGG + Intergenic
968265560 3:197360404-197360426 TGGCAGCTTCCACATGGTGTTGG + Intergenic
969265966 4:6064258-6064280 TGAAAGAATTCACCTGGGGAAGG + Intronic
970100366 4:12514721-12514743 TGGTAGCTTCCACATGGTGTTGG + Intergenic
970756837 4:19437309-19437331 TGGCAGCTTCCACATGGTGTTGG + Intergenic
971359582 4:25924278-25924300 TGGAAGAGTCAAAATGGTGTTGG + Intronic
972094693 4:35334248-35334270 TGGCAGCTTCCACATGGTGTTGG - Intergenic
972783866 4:42309324-42309346 GAGAAGAACCCACATGGGATAGG + Intergenic
972844412 4:42970501-42970523 TGGCAGCTTCCACATGGTGTTGG - Intronic
972847149 4:43004193-43004215 TGGTGGCATCCACATGGTGTTGG + Intronic
972890731 4:43553513-43553535 TGGCAGCTTCCACATGGTGTTGG + Intergenic
973642324 4:52915779-52915801 TGAAGGAATCAGCATGGGGTAGG - Intronic
974616063 4:64284058-64284080 TAGGAGAATACACATGGGGTTGG + Intronic
976050737 4:81009199-81009221 TGGCAGCTTCCACATGGTGTTGG + Intergenic
976058077 4:81092758-81092780 TGGAAGAATTGAGATGAGGTTGG - Intronic
976070097 4:81231366-81231388 TGGCAGCATCCACATGGTGTTGG + Intergenic
977098377 4:92774853-92774875 TGGAAGAGATCACATGTGGTGGG - Intronic
980534046 4:134092194-134092216 TGGAAAAAGCAACATTGGGTGGG - Intergenic
980650767 4:135712020-135712042 TGGCAGCTTCCACATGGTGTTGG + Intergenic
981733390 4:147923102-147923124 TGGAAGAATTTATATGTGGTTGG + Intronic
982389918 4:154852793-154852815 TGGAAGCTTACACATGGTGTTGG - Intergenic
983916946 4:173302471-173302493 TGGAAGAATCTGCATGCGTTAGG + Intronic
984057022 4:174942473-174942495 TGGCAGATTCCACATGGTATTGG - Intronic
984367906 4:178821977-178821999 TGGAAGAATCAAAAAGGGATGGG - Intergenic
985051874 4:185999284-185999306 TGGAAGAAAGCAGATGGGGCTGG - Intergenic
985607695 5:867172-867194 TGGAAGCTTCCACATGGTGTTGG + Intronic
985866224 5:2516502-2516524 TGGAAGGATCCAGGTGAGGTTGG + Intergenic
985906616 5:2842617-2842639 TGGGAGATTCCCCATCGGGTAGG - Intergenic
986084869 5:4434077-4434099 TGGAAGCTTCCACGTGGTGTTGG - Intergenic
987196914 5:15536073-15536095 TGGCAGCTTCCACATGGTGTTGG + Intronic
987655152 5:20797116-20797138 TGGCAGGTTCCACATGGTGTTGG - Intergenic
988040944 5:25888303-25888325 TGGGAGCTTCCACATGGTGTTGG - Intergenic
988147658 5:27331015-27331037 TGGCAGCTTCCACATGGTGTTGG + Intergenic
988366367 5:30305552-30305574 TGGAATGCTACACATGGGGTAGG + Intergenic
988768408 5:34406786-34406808 TGGCAGGTTCCACATGGTGTTGG + Intergenic
988983305 5:36593309-36593331 TGGAACACTGCCCATGGGGTTGG - Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990978689 5:61582016-61582038 TGGAAGAATGAACATGTGGATGG - Intergenic
991764288 5:69958112-69958134 TGGAGGATTCCATATGGTGTTGG + Intergenic
991783039 5:70160035-70160057 TGGAGGATTCCATATGGTGTTGG - Intergenic
991843520 5:70833184-70833206 TGGAGGATTCCATATGGTGTTGG + Intergenic
991875481 5:71160362-71160384 TGGAGGATTCCATATGGTGTTGG - Intergenic
993035214 5:82748549-82748571 TGGAAGAATCTACATGTGCCCGG - Intergenic
993390991 5:87319488-87319510 TGGTGGATTCCACATGGTGTTGG - Intronic
993618585 5:90142101-90142123 TGTAAGAAATCACATGGGCTGGG + Intergenic
993799876 5:92319591-92319613 TGGCAGCTTCCACATGGTGTTGG + Intergenic
999003441 5:147948368-147948390 TGAAAGAATCAACATTGGCTGGG - Intergenic
999541972 5:152584299-152584321 TGGAACAATCTGCTTGGGGTTGG + Intergenic
1000552075 5:162679338-162679360 TGGAAAACTCCACAAGTGGTTGG + Intergenic
1000609617 5:163359866-163359888 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1001447133 5:171794356-171794378 CGGAAGTGGCCACATGGGGTAGG - Intronic
1001632181 5:173183627-173183649 TGGCAGAACTCACCTGGGGTTGG - Intergenic
1003226904 6:4214236-4214258 TGGCAGTTTCCACATGGTGTTGG - Intergenic
1004591547 6:17056455-17056477 TGGAATAATCTTCATGGGGTGGG - Intergenic
1005783409 6:29217593-29217615 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1006167487 6:32073576-32073598 TGGAAGAAGGGCCATGGGGTGGG + Intronic
1006871904 6:37258585-37258607 AGGAAGAAGTCACTTGGGGTTGG - Intronic
1008261010 6:49366583-49366605 TGGTAGCTTCCACATGGTGTTGG - Intergenic
1011385797 6:86796549-86796571 TGGAAGCTTACACATGGTGTTGG - Intergenic
1013829551 6:114255691-114255713 TGGCAGCTTCCACATGGTGTTGG - Intronic
1013910688 6:115272617-115272639 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1014895204 6:126892774-126892796 TGGCAGCATCCACATGGTGTTGG + Intergenic
1017133564 6:151129085-151129107 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1017212335 6:151870810-151870832 AGGAAGCATCTACATGGGGTGGG - Intronic
1018477722 6:164159618-164159640 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1018897515 6:168030643-168030665 TTGAAGAATCCTGATGGCGTTGG + Intronic
1019136538 6:169912021-169912043 TGGAAGAAGACACAAGCGGTGGG + Intergenic
1019556279 7:1633168-1633190 TGGGTGAAGCCACATGGGGGTGG + Intergenic
1020388310 7:7631859-7631881 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1021096324 7:16539783-16539805 TGGCAGCTTCCACATGGTGTTGG + Intronic
1021323489 7:19239874-19239896 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1022512899 7:30952529-30952551 TGGCAGCTTCCACATGGTGTTGG - Intronic
1023353679 7:39345707-39345729 TGGAAGAATCCACATGGGGTAGG + Intronic
1023691550 7:42794219-42794241 TGAAAGAAGCCACAGGGAGTGGG + Intergenic
1024409962 7:49029018-49029040 TGGCAGAATCCACATGGCACAGG + Intergenic
1026210944 7:68304616-68304638 TGGAAGCATCCTCCTGTGGTAGG + Intergenic
1029257405 7:99278894-99278916 TGGAAGAATCCTCCTGGGCCAGG + Intergenic
1030557513 7:111045359-111045381 TGGAAGAATCCAGATGAGAAAGG - Intronic
1031330397 7:120456998-120457020 TGGAAGTTTCCACATGGTGTTGG - Intronic
1032602110 7:133308826-133308848 GGGAAGAATGGACATTGGGTGGG - Intronic
1033799303 7:144881394-144881416 TTGAAGAATAGAGATGGGGTGGG - Intergenic
1037725398 8:21478974-21478996 TGGAAGAAATCACATGGATTTGG + Intergenic
1039730200 8:40266785-40266807 TTGAAAAAACCACATGGGTTAGG + Intergenic
1040863458 8:52024175-52024197 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1042161841 8:65904710-65904732 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1042601310 8:70502377-70502399 TGGCAGCTTCCACATGGCGTTGG + Intergenic
1042827171 8:72991114-72991136 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1043796003 8:84540718-84540740 TGGAAGAATCTGCATGTGATTGG + Intronic
1043880688 8:85539312-85539334 GGGAGGAATCCAACTGGGGTGGG - Intergenic
1044066577 8:87706328-87706350 TGGCAGCTTCCACATGGAGTAGG - Intergenic
1045675866 8:104607560-104607582 TGGCAGCTTCCACATGGTGTTGG + Intronic
1046175561 8:110571044-110571066 TGGCAGTTTCCACATGGTGTTGG - Intergenic
1046311245 8:112440708-112440730 TGGCAGCTTCCACATGGCGTTGG - Intronic
1048057887 8:130886067-130886089 AGGGAGAATCCTTATGGGGTGGG - Intronic
1048325651 8:133437032-133437054 CGGAAGGGTCCACCTGGGGTAGG - Intergenic
1050028545 9:1361251-1361273 TGGAAAAAAACACATTGGGTAGG - Intergenic
1050293409 9:4180292-4180314 TGGAAGAATGTGAATGGGGTAGG - Intronic
1051267537 9:15323308-15323330 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1051285594 9:15492796-15492818 TGGCAGCTTCCACATGGTGTTGG - Intronic
1054862313 9:69966653-69966675 TGGCAGAAACCACATGGGACAGG - Intergenic
1055180486 9:73380532-73380554 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1055701275 9:78948129-78948151 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1056042849 9:82685888-82685910 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1056840868 9:89997172-89997194 TAGAAGCATCCACATGAAGTGGG - Intergenic
1057749456 9:97779938-97779960 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1058317056 9:103581322-103581344 TGGCAGCTTCCACATGGTGTAGG - Intergenic
1059971832 9:119676183-119676205 TTGAAGAATCCACAGGTGGCAGG + Intergenic
1060249342 9:121972470-121972492 TGGAAGAAGCCACACCTGGTGGG + Intronic
1060576279 9:124698353-124698375 TGGAAGAATCCACAGAGGAAAGG + Intronic
1061078833 9:128357836-128357858 TGGCAGAAGCCACATTGGCTAGG - Intronic
1061853184 9:133428081-133428103 TGGAGGACTCCTAATGGGGTGGG - Intronic
1062421790 9:136486109-136486131 TGTAAAACTCCACATGGGGCTGG + Intergenic
1062466305 9:136683080-136683102 GGGAAGAATCCAAAATGGGTGGG + Intronic
1185833596 X:3323843-3323865 TGGAAGAATCCAGCTAAGGTGGG + Exonic
1186301372 X:8203379-8203401 GGGATGAATCCACATGGATTTGG + Intergenic
1186523655 X:10228322-10228344 TGGAAGAATCCAGATGGGACTGG - Intronic
1187456059 X:19442207-19442229 TAGAGGAGTCCACATGGGCTAGG - Intronic
1188221510 X:27546660-27546682 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1188317277 X:28690095-28690117 TGGCAGAATGCAGAGGGGGTGGG + Intronic
1188703127 X:33290506-33290528 TGAATGAATCAACATGGGTTGGG - Intronic
1188873138 X:35398571-35398593 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1189815773 X:44823008-44823030 TGGTAGCTTCCACATGGTGTTGG + Intergenic
1191089904 X:56608866-56608888 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1192335615 X:70216942-70216964 TGGAAGCTTCCACGTGGTGTTGG + Intergenic
1192450481 X:71241694-71241716 TGGACTAATGCACAAGGGGTTGG - Intronic
1193585671 X:83318587-83318609 TGGCAGCATCTACATGGTGTTGG + Intergenic
1193777163 X:85657406-85657428 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1193816209 X:86107529-86107551 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1193827287 X:86241883-86241905 TGGCAGCTTCCACATGGTGTTGG + Intronic
1193850489 X:86531535-86531557 TGGCAGCTTCCACATGGTGTTGG + Intronic
1194053829 X:89105249-89105271 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1194778205 X:97991406-97991428 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1194841730 X:98752235-98752257 TGGCAGCTTCCACATGGTGTTGG - Intergenic
1195746739 X:108126210-108126232 TGTAAGAACCCAGATGAGGTAGG + Intronic
1197464261 X:126784100-126784122 TGGCAGCATCCACATGGTGTTGG + Intergenic
1198734148 X:139767878-139767900 TGGAAGACTACACAAGGGATGGG + Intronic
1199206956 X:145160126-145160148 TGGCAGCTTCCACGTGGGGTTGG - Intergenic
1199236563 X:145500505-145500527 TGGAAGAAGACACATTGTGTGGG - Intergenic
1199420340 X:147637140-147637162 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1200008691 X:153105436-153105458 TGGGAGAAACCACATGGTGGAGG + Intergenic
1200031218 X:153297425-153297447 TGGGAGAAACCACATGGTGGAGG - Intergenic
1200346216 X:155452014-155452036 TGGCAGCTTCCACATGGTGTTGG + Intergenic
1201242124 Y:11969192-11969214 TGGAAGAATCCAGCTAAGGTGGG - Intergenic