ID: 1023362114

View in Genome Browser
Species Human (GRCh38)
Location 7:39427719-39427741
Sequence GACCTATCAATGCTGTAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023362114_1023362115 -3 Left 1023362114 7:39427719-39427741 CCGATTTACAGCATTGATAGGTC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1023362115 7:39427739-39427761 GTCTCCTTTTCTTACGTATATGG No data
1023362114_1023362116 -2 Left 1023362114 7:39427719-39427741 CCGATTTACAGCATTGATAGGTC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1023362116 7:39427740-39427762 TCTCCTTTTCTTACGTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023362114 Original CRISPR GACCTATCAATGCTGTAAAT CGG (reversed) Intronic
904406721 1:30295807-30295829 GACCTTTCAATGCTGGTAAGTGG - Intergenic
912748904 1:112269162-112269184 AACCTATTAATACTGTCAATTGG - Intergenic
913540256 1:119812998-119813020 GTCCTATCAATGCCTTAATTTGG - Intergenic
916775397 1:167957644-167957666 GACCTAGCAATTCTGCAACTAGG - Intronic
917071159 1:171152380-171152402 GACCTCTCAAGGCTTAAAATGGG + Intronic
917731771 1:177881732-177881754 GACTTACTAATGCTGTAACTTGG + Intergenic
918699508 1:187589909-187589931 GACCCTACAATGCTGAAAATAGG - Intergenic
921642736 1:217575053-217575075 GACCTATAAATGATGTTAAGTGG - Intronic
923420296 1:233808144-233808166 TACCTACCAATGCTCTTAATGGG - Intergenic
924060038 1:240164785-240164807 GCCCTATAAATGCTATAAGTGGG - Intronic
1063669752 10:8090579-8090601 CACCTGTCAATGCTATAAAAAGG + Intergenic
1065607186 10:27429923-27429945 GACCTATGAATCCTGGATATAGG - Intergenic
1068501255 10:57841796-57841818 GACCAATCAACACTGTAAAATGG + Intergenic
1072646362 10:97258102-97258124 AACCTATCAACGATGTTAATAGG + Intronic
1081425545 11:42922406-42922428 GACCTAGTAATCCTGTTAATGGG - Intergenic
1088303398 11:108383106-108383128 GACATATCAAAGATGCAAATGGG - Exonic
1092536348 12:9391337-9391359 TACATATCTGTGCTGTAAATTGG + Intergenic
1101276252 12:103204866-103204888 GATGTATCAATATTGTAAATAGG - Intergenic
1105252012 13:18707673-18707695 GACCTAACCATCCTCTAAATTGG + Intergenic
1105468515 13:20669722-20669744 GACCTCTAAATGCTGAAAATAGG - Intronic
1106749171 13:32740863-32740885 GATCTATAAGTGCTGTACATAGG + Intronic
1108141274 13:47424283-47424305 GACCTATTAATGCTGGAATCAGG - Intergenic
1109522261 13:63529494-63529516 GATCTGTCAATGCTGAAAGTGGG + Intergenic
1110555487 13:76854957-76854979 GACTAAACAAAGCTGTAAATTGG - Intergenic
1113554100 13:111217465-111217487 GACCTTTGAATGCTGTGAAGAGG + Intronic
1114780245 14:25531298-25531320 CACCTATCAGAGCTGTGAATAGG + Intergenic
1116158201 14:41235225-41235247 GACCTATGAATGCTGGCTATGGG + Intergenic
1116432767 14:44866240-44866262 GACATATAAAAGATGTAAATTGG - Intergenic
1116718845 14:48466386-48466408 GACATATCAATGATATCAATGGG + Intergenic
1117016809 14:51526517-51526539 GACCTATCACTGTGGTCAATGGG - Intronic
1124643500 15:31416911-31416933 CACCTCTCAATGCTTTACATTGG - Intronic
1126301425 15:47201327-47201349 GGCCTATGAATTTTGTAAATGGG - Intronic
1137373230 16:47928225-47928247 GACCAATCAACACTGTAAAATGG - Intergenic
1152287181 17:79419814-79419836 GACTTATGAATGCTGTAAGATGG + Intronic
1157937260 18:51886839-51886861 TACCTATCCATGCTGTAAATGGG + Intergenic
929408107 2:41666302-41666324 AACCTTACAATTCTGTAAATCGG + Intergenic
930403669 2:50926128-50926150 TTCCTATCAATGCTGCCAATGGG - Intronic
931615922 2:64157827-64157849 TACCTCTCAAAGCTGTACATGGG - Intergenic
939806435 2:146779900-146779922 GACCCATCAATCCTGGATATGGG - Intergenic
940267633 2:151856650-151856672 GACCAAACAATGCTGTAATCTGG + Intronic
946419487 2:219556976-219556998 GACAAGTAAATGCTGTAAATAGG - Intronic
1170328102 20:15178583-15178605 TCCCTATCAATCCTGAAAATGGG + Intronic
1170581898 20:17705593-17705615 GACTTTTCAAAGCCGTAAATAGG + Intronic
1174205765 20:48837299-48837321 GACCCAGCAATGCTGTTACTGGG + Intergenic
1175211991 20:57364803-57364825 GACCAATGACTGTTGTAAATTGG + Intronic
1179334589 21:40438593-40438615 GACCTATCATTGCTGGTAATAGG + Intronic
955917385 3:63920247-63920269 AACCAATCAAAACTGTAAATTGG - Intronic
956723075 3:72135402-72135424 GAACTTTCAGTGCTGAAAATTGG + Intergenic
959431721 3:106262341-106262363 GACCTAGGAATGCTGTTACTGGG + Intergenic
962180573 3:133201813-133201835 GACCTAGCAATCCTGTTACTGGG - Intronic
972709300 4:41578487-41578509 CAGCTATCAAGGGTGTAAATTGG - Intronic
974614468 4:64264484-64264506 GAACTACCAATGCTGTAGCTTGG - Intergenic
978493271 4:109331840-109331862 TACTTATAAATGCTGTAAGTTGG + Intergenic
978891665 4:113836188-113836210 GACTTACCAATGCTTTGAATTGG - Intergenic
978944711 4:114481724-114481746 GACCAATCAACTCTGTAAAATGG - Intergenic
981942584 4:150299455-150299477 AACCTATAAATACTGTAATTTGG - Intronic
983337720 4:166418095-166418117 GATCTGCCAATGCTGAAAATGGG + Intergenic
986605529 5:9519773-9519795 GCCCTTTCAAGTCTGTAAATTGG + Intronic
990270262 5:54129924-54129946 GACATTTTAATGCTGAAAATGGG - Intronic
996381541 5:122867025-122867047 GACCTATCAATCCTGGCTATGGG + Intronic
1002965729 6:1964657-1964679 GACCTATTAGTGATCTAAATTGG - Intronic
1007944129 6:45810241-45810263 GAACTTTCAATGCTATAATTGGG - Intergenic
1008126329 6:47673337-47673359 GACCTATGAAAGCTTCAAATTGG + Intronic
1010853607 6:80809681-80809703 GACATATCTATGCAGTAAAAAGG + Intergenic
1015156029 6:130097121-130097143 GAGCTTTAAGTGCTGTAAATAGG - Intronic
1015341546 6:132106701-132106723 GGCCCATCAATGGTGTAAAATGG - Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018858574 6:167693586-167693608 GACCAATCAACACTGTAAAATGG + Intergenic
1021274236 7:18629500-18629522 GACCTATGAATGCTGGGAGTAGG + Intronic
1022080575 7:27016280-27016302 GATCTATCAATGCTGAAAGTGGG - Intergenic
1023362114 7:39427719-39427741 GACCTATCAATGCTGTAAATCGG - Intronic
1025971096 7:66326084-66326106 GTTCAATCTATGCTGTAAATTGG + Intronic
1030990615 7:116294866-116294888 GATCTGTCAATGCTGAAAGTGGG - Intronic
1032513263 7:132488823-132488845 GACCTATTAAAGTTGCAAATGGG - Intronic
1035902689 8:3474711-3474733 GACCTATTAATGATGTTAAGTGG + Intronic
1037699684 8:21263212-21263234 GTCCTAGCAATGCTCTACATAGG - Intergenic
1042682435 8:71400764-71400786 GACCTATCAATCCTATTACTGGG + Intergenic
1042819144 8:72911135-72911157 GACCTTATAATGCTGTAAATGGG - Intronic
1043275078 8:78382931-78382953 GACCTCTATATGCTGTCAATTGG - Intergenic
1043728725 8:83647693-83647715 GATCTATCAATTCTGAAACTAGG - Intergenic
1047357267 8:124134942-124134964 GACCTAGCAATCCCGTAATTGGG + Intergenic
1048234718 8:132678288-132678310 AACCTAACAATGCTGTACACTGG + Intergenic
1051704601 9:19863308-19863330 GATCTGTCAATGCTGAAAGTGGG - Intergenic
1051739577 9:20238541-20238563 CAGCAATCAATGCTTTAAATGGG + Intergenic
1052489820 9:29151100-29151122 TTCATAACAATGCTGTAAATAGG - Intergenic
1053328243 9:37176846-37176868 TAGCTATGAATTCTGTAAATGGG + Intronic
1191027787 X:55933931-55933953 GACCTATCCATGCTGCAATTTGG - Intergenic
1193283360 X:79682883-79682905 AACATATGAATGCAGTAAATTGG + Intergenic
1197010857 X:121561482-121561504 GAACAAACTATGCTGTAAATGGG - Intergenic
1199323067 X:146463675-146463697 GACTTGTCACTGCTGTAAAGTGG - Intergenic