ID: 1023362642

View in Genome Browser
Species Human (GRCh38)
Location 7:39432081-39432103
Sequence ACATAGAGACCATATTGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023362642_1023362644 -10 Left 1023362642 7:39432081-39432103 CCCTAACAATATGGTCTCTATGT 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1023362644 7:39432094-39432116 GTCTCTATGTCCAGATTCTATGG No data
1023362642_1023362649 28 Left 1023362642 7:39432081-39432103 CCCTAACAATATGGTCTCTATGT 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1023362649 7:39432132-39432154 ATTTGCTGTTTTTCTATTCATGG 0: 1
1: 0
2: 3
3: 87
4: 890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023362642 Original CRISPR ACATAGAGACCATATTGTTA GGG (reversed) Intronic
905997614 1:42395219-42395241 ACATAGAGAAAATATTGTTTTGG + Intronic
910536366 1:88302513-88302535 ACATAGGAACCATTTTGTTCTGG + Intergenic
910895315 1:92063228-92063250 ACATAGTGAACAAATTGATATGG + Exonic
916092256 1:161316570-161316592 AAAGAGAGATCAGATTGTTAAGG - Intronic
917013184 1:170498456-170498478 AAAGAGAGACCATGCTGTTAAGG - Intergenic
917831078 1:178887040-178887062 AAATAGAGACCATATTAGAAAGG + Intronic
918399184 1:184146597-184146619 ACATATTGATCATCTTGTTATGG - Intergenic
918769719 1:188540849-188540871 ATATAGATACCATATTAATAAGG - Intergenic
919438929 1:197602041-197602063 AAAAAGAGACCATGTTGTGATGG - Intronic
921784202 1:219207924-219207946 ACTTACAGACCATGATGTTAGGG - Intronic
922932541 1:229401721-229401743 AAATAGAGACCATGTTGCAAAGG - Intergenic
924720957 1:246622582-246622604 ACATTGAGACTTTATTTTTAGGG + Intronic
924950957 1:248882983-248883005 ACATACATACCATTTTTTTAAGG - Intergenic
1062901642 10:1151096-1151118 TCATAGAGAACATTTTGTGAAGG - Intergenic
1065551739 10:26874578-26874600 ACCAGGAGACAATATTGTTAAGG - Intergenic
1067559634 10:47295803-47295825 ACAGAGAGGCCAGATGGTTAGGG + Intergenic
1068117261 10:52748902-52748924 AAATGGAGATCATATTCTTAAGG + Intergenic
1074843693 10:117378057-117378079 ACACAGATACCATTGTGTTATGG + Intergenic
1077604091 11:3595624-3595646 AAATAGAGACCATATTGGCCAGG + Intergenic
1081360647 11:42173151-42173173 GAGTAGAGACCATATTGATAGGG + Intergenic
1084259986 11:67970213-67970235 AAATAGAGACCATATTGGCCAGG + Intergenic
1087926060 11:103919917-103919939 ACACAGAGTCAATATTTTTAAGG + Intronic
1088892147 11:114053275-114053297 ACATAGAGACCAAATATTTTAGG - Intergenic
1092900406 12:13054409-13054431 ATATGGAGACCAGATTGTTGCGG - Intronic
1098574154 12:72022049-72022071 AAATATATAGCATATTGTTACGG + Intronic
1111781498 13:92731993-92732015 ACATAAAGAACAGATTCTTATGG - Intronic
1112414211 13:99190868-99190890 ACATGGAGACCATGTAGTTGAGG + Intergenic
1114055358 14:18963537-18963559 ACATAGAGTCCATAGAGTCAAGG + Intergenic
1116979113 14:51149335-51149357 ACATAGAGGCCAGCTTATTAAGG - Intergenic
1120365072 14:83557605-83557627 AAGTAGAGACCATAAAGTTAGGG + Intergenic
1125192391 15:37008966-37008988 TCACAGAGACCATACTTTTATGG - Intronic
1125884458 15:43218295-43218317 ACGTAATGACCATAGTGTTACGG + Intronic
1129555426 15:76503287-76503309 AAATAAAGTCCATATTGATAAGG + Intronic
1137575530 16:49597372-49597394 AAATACACACCATATTGTTAAGG + Intronic
1137857466 16:51809438-51809460 AAATATTGAACATATTGTTATGG - Intergenic
1138640175 16:58379527-58379549 AGATAGAAACCAGGTTGTTATGG + Intronic
1138640814 16:58385079-58385101 AGATAGAGACCAGATGGTTATGG + Intronic
1156644651 18:39146452-39146474 ACCTGGGGACCATATTTTTAAGG + Intergenic
1157080773 18:44522724-44522746 TCATAGGGATGATATTGTTATGG - Intergenic
1164414653 19:28036587-28036609 ACATAGAGAAAATATGGATATGG + Intergenic
931067871 2:58607136-58607158 AAATAGGAAACATATTGTTAAGG - Intergenic
933119531 2:78519475-78519497 ACATAGGGACAATATTTTTTTGG + Intergenic
933578649 2:84099915-84099937 GCATAGAAACCATATTGGTTAGG + Intergenic
942437487 2:175996239-175996261 ACATAGAGAACCTATTTTAAAGG - Intronic
942673860 2:178405992-178406014 AGAGAGAGAGGATATTGTTAAGG - Intergenic
945854853 2:215057114-215057136 AAAAAGAGACCATATTGTTGGGG + Intronic
1169856522 20:10109511-10109533 AAATAGAGAACATACTTTTATGG - Intergenic
1170101382 20:12703451-12703473 ACATAGACACCATACTGTGGTGG - Intergenic
1171251795 20:23654509-23654531 ACATAGCCACCATAGTGTTCAGG + Intergenic
1177563864 21:22793771-22793793 ACATAGAGAGCATATTCTAAGGG + Intergenic
1179129099 21:38618492-38618514 ACTTAGGGACCTTATAGTTAAGG - Intronic
1179305230 21:40147907-40147929 ACAGAGAAACTATATTGTGAAGG - Intronic
949310371 3:2690563-2690585 AAATAAAGAGGATATTGTTAAGG - Intronic
954346406 3:50003361-50003383 ACTTACAGACCAAATTGGTATGG + Intronic
955539940 3:59964112-59964134 AGATAAAAACCAAATTGTTATGG - Intronic
956442709 3:69295796-69295818 AGAAAGAAACCATATTGTGAAGG - Intronic
957645533 3:82919420-82919442 AAATAGAGAGCAGATTTTTATGG + Intergenic
957890336 3:86348921-86348943 ACCTAGAGAACATTATGTTAAGG - Intergenic
962783312 3:138742050-138742072 ACAAAGAGACCATTTTGATTAGG + Intronic
963584739 3:147171875-147171897 ACATTGAGCCCATTTTTTTAAGG - Intergenic
964305194 3:155332285-155332307 ACATAGAGTCCATTTTGTCTGGG + Intergenic
965203920 3:165696185-165696207 ACATATAGACCATCTTAATAGGG - Intergenic
965697277 3:171422433-171422455 ACATAAAGACAATATTTATATGG + Intronic
969018534 4:4122275-4122297 AAATAGAGACCATATTGGCCAGG + Intergenic
969786755 4:9464253-9464275 AAATAGAGACCATATTGGCCTGG - Intergenic
969794667 4:9517897-9517919 AAATAGAGACCATATTGGCCAGG - Intergenic
972558752 4:40206734-40206756 ATATAGTGACAATATTGTTTTGG - Intronic
977909227 4:102512869-102512891 ACATAAAGGACATATTTTTATGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980497265 4:133602746-133602768 ACAAAGAAACCATATTCTTTAGG + Intergenic
985933812 5:3079586-3079608 AGTTAGAGACCATATTATTGGGG + Intergenic
988827799 5:34956881-34956903 AAATGGAGACAATATTATTATGG - Exonic
989685936 5:44087363-44087385 ATTTAGAGGCCATATTGTAAAGG + Intergenic
993166907 5:84367846-84367868 ACATAGAGCTTATATTGTAATGG - Intronic
993843145 5:92905934-92905956 ACATAGAGCCCATCTTTTGATGG + Intergenic
997575022 5:134968215-134968237 TCATAGAAACCAGATTGTCAAGG - Exonic
998742479 5:145220324-145220346 ACATAGAGACCAGACTCTTCAGG + Intergenic
999143616 5:149378743-149378765 AAAGAGAGAGCCTATTGTTAGGG - Intronic
1000814463 5:165903832-165903854 ACCAATAGACCATACTGTTATGG + Intergenic
1001797325 5:174513418-174513440 ACATGTAGACCATGTTGTTGAGG - Intergenic
1004783674 6:18941205-18941227 ACTAAGAGACCATGATGTTATGG + Intergenic
1005743811 6:28817304-28817326 ACAAAGAGACCTTATAGTGAGGG - Intergenic
1005907270 6:30274349-30274371 ACATACACACCATATTGCTATGG - Intergenic
1008187203 6:48408822-48408844 ACAGAGAGAGCATATTTGTAAGG - Intergenic
1009507872 6:64507806-64507828 ACAAAGAGAGCTTATTGTCATGG - Intronic
1011263153 6:85489227-85489249 ACCGAGAGACCATTTTGCTAAGG + Intronic
1013395575 6:109735649-109735671 TCACAGAGACCAGTTTGTTATGG + Intronic
1014829476 6:126085089-126085111 ACATAGTTACCATTTTGTTAGGG - Intergenic
1016376632 6:143427942-143427964 ATATAGAGACCATAATTATATGG - Exonic
1016507302 6:144797042-144797064 ACACAGAAAGCATATTGCTATGG - Intronic
1017208759 6:151832231-151832253 ACATAGCTACCACATGGTTAGGG + Intronic
1018166110 6:161098480-161098502 ACACAGCAACCATAGTGTTAGGG + Intronic
1021919320 7:25468102-25468124 ACATTGTGACCACATTGGTAAGG - Intergenic
1022825534 7:34008771-34008793 ATATAGATAGCATCTTGTTAGGG + Intronic
1023362642 7:39432081-39432103 ACATAGAGACCATATTGTTAGGG - Intronic
1026136111 7:67662490-67662512 ACACAGGGACAATATTGTGAGGG - Intergenic
1026274293 7:68863298-68863320 ACATAGAAAGCAAATTGTCAGGG + Intergenic
1028657392 7:93225093-93225115 ACTTAGAGACAATTTAGTTAAGG - Intronic
1030575978 7:111286570-111286592 TCATAGAGACCGTTTTGATAAGG + Intronic
1030611169 7:111690796-111690818 ATATATACAACATATTGTTAAGG + Intergenic
1031636010 7:124101805-124101827 ACATAAAAACCATATTTTAAAGG + Intergenic
1033502087 7:141961744-141961766 ACATACATACCATATTTTTGTGG - Intronic
1036511834 8:9407472-9407494 ACATTGAGACCATTTGTTTAAGG + Intergenic
1036826549 8:11980958-11980980 ACATATAGAACATATATTTAAGG - Intergenic
1037791595 8:21948334-21948356 ACACAAAGACCATTGTGTTACGG + Intronic
1038954530 8:32452729-32452751 AGATAGATACCATATTCTTTTGG - Intronic
1042291916 8:67177890-67177912 ATATAGAAAACATATTGTAATGG + Intronic
1042299415 8:67260387-67260409 ACAAAGAGAGCATATGGTTTTGG - Intronic
1043958418 8:86389569-86389591 AAAGAGAGATCAGATTGTTACGG - Intronic
1044198070 8:89402281-89402303 AATTAGAGACCATAGTTTTATGG - Intergenic
1045500953 8:102743973-102743995 AAAAAAAGACCCTATTGTTACGG - Intergenic
1046534867 8:115496322-115496344 AAATAAAGACCATTGTGTTATGG + Intronic
1046966881 8:120177346-120177368 ACATAAAGACTATATAGTAAGGG + Intronic
1047036843 8:120949064-120949086 CCATAGAGAGCAACTTGTTATGG - Intergenic
1048567810 8:135621837-135621859 CCATAGAGAACATTTTGTGATGG + Intronic
1051605493 9:18914193-18914215 ACATATAAACCATATCTTTAGGG - Intergenic
1051941667 9:22513625-22513647 ACATACAGACTATTTGGTTAGGG + Intergenic
1053241913 9:36502776-36502798 ACATATAGACCATACTGGTCAGG + Intergenic
1058262074 9:102846942-102846964 ACATCGAGAACATTTTGTCAGGG + Intergenic
1058343926 9:103935496-103935518 AGATAGAGACCATTATTTTAAGG + Intergenic
1058645319 9:107126831-107126853 AGGTTGAGACCAGATTGTTAGGG - Intergenic
1188058506 X:25570651-25570673 ACATAGTTACCATATTTTTGGGG + Intergenic
1192996293 X:76516401-76516423 ACAAAGAGACCATGATGGTAGGG + Intergenic
1193120693 X:77820074-77820096 GCATGGAGACCATAGTCTTAGGG - Intergenic
1194390118 X:93307056-93307078 AAATATAGCCCATATAGTTAAGG - Intergenic
1195383803 X:104295067-104295089 ATATGGAGACTATACTGTTAAGG + Intergenic
1195825678 X:108997926-108997948 ACATTAAGACCATATTGTGGAGG - Intergenic
1199657391 X:150010003-150010025 ACATAGACAACATATTTATAAGG + Intergenic
1200363555 X:155636503-155636525 ACATATACACCATATGGTTTTGG - Intronic