ID: 1023365080

View in Genome Browser
Species Human (GRCh38)
Location 7:39456053-39456075
Sequence GGCCCTGTCTTTAATATATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023365078_1023365080 -2 Left 1023365078 7:39456032-39456054 CCATCATTGCTATTACTTTCTGG 0: 1
1: 0
2: 1
3: 18
4: 231
Right 1023365080 7:39456053-39456075 GGCCCTGTCTTTAATATATCAGG 0: 1
1: 0
2: 0
3: 2
4: 99
1023365077_1023365080 3 Left 1023365077 7:39456027-39456049 CCTGGCCATCATTGCTATTACTT 0: 1
1: 1
2: 0
3: 19
4: 266
Right 1023365080 7:39456053-39456075 GGCCCTGTCTTTAATATATCAGG 0: 1
1: 0
2: 0
3: 2
4: 99
1023365076_1023365080 4 Left 1023365076 7:39456026-39456048 CCCTGGCCATCATTGCTATTACT 0: 1
1: 0
2: 0
3: 20
4: 228
Right 1023365080 7:39456053-39456075 GGCCCTGTCTTTAATATATCAGG 0: 1
1: 0
2: 0
3: 2
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023365080 Original CRISPR GGCCCTGTCTTTAATATATC AGG Intronic
908848109 1:68345387-68345409 GGCCCTGTTTCTAATATTGCAGG + Intergenic
909923298 1:81408056-81408078 GGCCCTGTCTTTCTTTAATCAGG + Intronic
911872496 1:103116877-103116899 GTACCTGTCTTTTATGTATCAGG - Intergenic
912771928 1:112472082-112472104 GTCAATGTCTTTAATATATTTGG - Intronic
914096621 1:144549735-144549757 GGCAGTGTCTTTAAGATATTTGG - Intergenic
914301987 1:146385058-146385080 GGCAGTGTCTTTAAGATATTTGG + Intergenic
918545649 1:185680727-185680749 GGCCCTGGCTTTACTTTACCTGG + Intergenic
921958724 1:221011784-221011806 TGACCTGTATTCAATATATCTGG + Intergenic
922975246 1:229778746-229778768 AGCCCTGGCTTTCATTTATCTGG - Intergenic
1063683775 10:8216119-8216141 GGCCCTTTCTTTATTTTTTCTGG + Intergenic
1070633709 10:78106961-78106983 GGCCCTGTCTTTGCTGTCTCTGG - Intergenic
1072681787 10:97512872-97512894 GGCCCTGTCCTTCATGTGTCTGG + Intronic
1074267281 10:111917243-111917265 GGAGCTGTCTTTGAGATATCTGG + Intergenic
1074320762 10:112400062-112400084 GGGCCTGTACTTAGTATATCTGG + Intronic
1077470198 11:2754451-2754473 GGCCCTGCCTTCCAGATATCAGG + Intronic
1080328713 11:31109989-31110011 GGCCCTGGTTTTGATACATCAGG - Intronic
1086612948 11:88778757-88778779 GGTCCTGTCTTTAAGTGATCTGG + Intronic
1087932278 11:103991700-103991722 GGCCATATTATTAATATATCAGG - Intronic
1092952592 12:13521201-13521223 GACCCTGTCCTTTAAATATCAGG - Intergenic
1095335798 12:41024261-41024283 TGCCCTGTCTATAAAATAACGGG - Intronic
1098299908 12:69043437-69043459 GGCCTTATTTTTAATGTATCTGG - Intergenic
1099718699 12:86333106-86333128 GTACCTGTCATTAATTTATCAGG - Intronic
1107613412 13:42139861-42139883 GTCCCTGTCTTTAAAGTATGTGG + Intronic
1107615276 13:42160584-42160606 GGCCCTGTCCTCACCATATCTGG - Intronic
1114835155 14:26195431-26195453 GGCCCAGTCTTTCACATAGCTGG + Intergenic
1115908490 14:38228518-38228540 GGATCTATCTTTAATATATCAGG + Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1120035561 14:79693393-79693415 TGCCCTGTTTTTAATGTATGTGG + Intronic
1120346730 14:83299861-83299883 AGACCTATCTTTAATGTATCCGG - Intergenic
1121926697 14:97933443-97933465 AGCCCTGTCTTGAACATCTCGGG + Intronic
1123960249 15:25391008-25391030 GAACCTGTTTTTAATATATTTGG - Intronic
1124433337 15:29626282-29626304 GGCCCTGCCTTTGACATGTCGGG - Intergenic
1125446449 15:39762700-39762722 GGCCTTGTCTTTAAGAAAACAGG - Intronic
1126028937 15:44477218-44477240 GACCCTGTCTTTAATAAAAAGGG + Intronic
1129336906 15:74857723-74857745 GGCCATGTCTTTAAGATTTTAGG - Intronic
1131671083 15:94620089-94620111 GGTCCTCTTTTTAATAAATCTGG + Intergenic
1142478827 17:205568-205590 GACCCTGTCTCAAATATATGTGG - Intergenic
1146666052 17:34704411-34704433 GCCCCTGTCTTTGTTATAGCAGG - Intergenic
1150915055 17:69428452-69428474 GGCCCTAACTTTAATATGACTGG - Intronic
1153456428 18:5287645-5287667 GGCCCTGGGTGTAATTTATCTGG - Intergenic
1158981766 18:62769553-62769575 TGCTCTGTCTTTCATATACCAGG + Intronic
929128682 2:38544459-38544481 GGCCCAGCCTATAATACATCTGG - Intergenic
931507145 2:62941741-62941763 GGGCCTGTATTTAATATGTAAGG + Intronic
932339505 2:70952757-70952779 GGCTCTATCTTTAATGTATTTGG + Intronic
933424072 2:82087560-82087582 GGCCCTGTCTTTGACACATAAGG + Intergenic
939114609 2:138046167-138046189 GGCTCTGACTTTAATCTGTCAGG + Intergenic
940041508 2:149366517-149366539 GGCTCTGTGTTTATAATATCTGG - Intronic
942110820 2:172681159-172681181 GGCACTGTATTTAATTTATTGGG + Intergenic
943804600 2:192108342-192108364 TGCCCTGTCTTTCATACATGTGG - Intronic
945082988 2:206104799-206104821 GGCCCTGTCTGTAATAAAAAAGG + Intergenic
946870509 2:224080114-224080136 GGCCAGGTATTAAATATATCTGG + Intergenic
1169287390 20:4321001-4321023 GGCCCTGTGTTTGAGATACCAGG - Intergenic
1169474190 20:5916201-5916223 GGCAATGTCTTAAATATATTTGG - Intronic
1169620728 20:7503814-7503836 GGCCCTGTCTTTGTTCTACCAGG - Intergenic
1170401466 20:15988823-15988845 GGTCCTGCCTTGAATATTTCTGG + Intronic
949568531 3:5268801-5268823 GTCCCTTTCTTTTAAATATCTGG + Intergenic
950485423 3:13270556-13270578 GCCCCTGTCTTTATTCTCTCTGG + Intergenic
959460186 3:106615889-106615911 GGCCCTGTCTCTATCATCTCAGG - Intergenic
961692599 3:128680831-128680853 GGCGCTGTCTTTGACCTATCCGG - Intronic
962169538 3:133086604-133086626 GGCCCTCTCTTTATTAGATGAGG + Intronic
967138046 3:186529155-186529177 CTTCCTGTCTTGAATATATCAGG - Intergenic
977156192 4:93577007-93577029 GTCCATGTTTTTAATATAACAGG + Intronic
979620642 4:122795266-122795288 GGCTCTTTCTTTGATATATTCGG + Intergenic
982799662 4:159688444-159688466 GACCCTGTCTTTCAAATATTGGG + Intergenic
985309618 4:188582843-188582865 GGACCTTTCTGTAATAAATCAGG - Intergenic
987808239 5:22798527-22798549 GTGACTGTGTTTAATATATCTGG - Intronic
990679411 5:58224271-58224293 GGCTATGTCTTTGATATATATGG - Intergenic
992909331 5:81379897-81379919 TAGACTGTCTTTAATATATCTGG - Intronic
1005668623 6:28082073-28082095 GGCCATTTCTTTGATATTTCTGG - Intronic
1006682093 6:35804872-35804894 GGCCCTGTCTTTTTTATCTGTGG + Intergenic
1009271669 6:61622448-61622470 GGCACTCTCTTGAATCTATCTGG - Intergenic
1009937754 6:70253614-70253636 GGGCATGACTTTACTATATCTGG + Intronic
1010095469 6:72038245-72038267 GTCACTGTGGTTAATATATCTGG - Intronic
1012108172 6:95192896-95192918 GGCCAAGTCTTTAATGTATATGG + Intergenic
1017977608 6:159371993-159372015 GGCCCTATCAATAATATATCTGG + Intergenic
1018312107 6:162521052-162521074 GGCCCTTTCTTAAATAGAGCTGG - Intronic
1020627337 7:10597936-10597958 GGTAATGTCTTTAATTTATCTGG + Intergenic
1022748505 7:33198898-33198920 GGCACTGTTCCTAATATATCAGG - Intronic
1023365080 7:39456053-39456075 GGCCCTGTCTTTAATATATCAGG + Intronic
1026424034 7:70271750-70271772 GGCCCTGGCTCAAATAAATCAGG - Intronic
1027531888 7:79344936-79344958 TTCCCTGTCTTTAATTTCTCTGG + Intronic
1028045705 7:86116393-86116415 GGCCCAGCCTTTCATAGATCAGG + Intergenic
1030139001 7:106285610-106285632 GACCCTGTCTTTAAGATCCCAGG + Intronic
1031398227 7:121299488-121299510 AGCCCTTTTTGTAATATATCTGG + Intergenic
1034836042 7:154352163-154352185 GGCCTTGTCTTTAATGTTTAAGG - Intronic
1036949558 8:13128332-13128354 GGCTCTGTCTTTAACATTTGGGG - Intronic
1037093484 8:14952772-14952794 AGCTCTGTCTTTAATACCTCGGG - Intronic
1038337504 8:26657223-26657245 GGCCATGTGTTTAATTTATAAGG - Exonic
1039346565 8:36711679-36711701 AGCCCTGGCTTTAATATACAAGG + Intergenic
1039831278 8:41216995-41217017 GGCCTTATCTTTAATATGACCGG - Intergenic
1042703299 8:71640345-71640367 GGCCTTTTTTTTAAGATATCGGG + Intergenic
1042945640 8:74152193-74152215 GTCCCTGTGTTTGTTATATCGGG + Intergenic
1044996386 8:97841622-97841644 GGGCTTATCTTTAAGATATCTGG - Intronic
1046132143 8:109978905-109978927 GGCTCTGTCTTTGATTTCTCAGG + Intergenic
1046228347 8:111316865-111316887 GGCCATTTCTTTAATTTATATGG + Intergenic
1047979202 8:130162518-130162540 GGCCATGTTTTTAATGTTTCTGG - Intronic
1051024018 9:12584250-12584272 GGCTCTGACTTGAAAATATCTGG - Intergenic
1052477075 9:28973428-28973450 GGCCCTGTCTTTGACATGTGGGG - Intergenic
1055608169 9:77993082-77993104 GGCGCTGTGTTTTATATATAAGG - Intronic
1190280319 X:48924926-48924948 GGCCCTGTTTTCAGTATATGGGG - Intronic
1194813364 X:98414188-98414210 GGCCTGGTCTTCAACATATCTGG - Intergenic
1200385954 X:155891066-155891088 GGCCCTGCCTTTAAAATTACTGG - Intronic