ID: 1023365395

View in Genome Browser
Species Human (GRCh38)
Location 7:39458545-39458567
Sequence GCTCCAGGCTGATGTGCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023365390_1023365395 4 Left 1023365390 7:39458518-39458540 CCACAATCCTTAGCGAGCCCGGA 0: 1
1: 0
2: 0
3: 3
4: 21
Right 1023365395 7:39458545-39458567 GCTCCAGGCTGATGTGCTCGTGG 0: 1
1: 0
2: 0
3: 11
4: 165
1023365391_1023365395 -3 Left 1023365391 7:39458525-39458547 CCTTAGCGAGCCCGGAAGCAGCT 0: 1
1: 0
2: 1
3: 6
4: 54
Right 1023365395 7:39458545-39458567 GCTCCAGGCTGATGTGCTCGTGG 0: 1
1: 0
2: 0
3: 11
4: 165
1023365388_1023365395 5 Left 1023365388 7:39458517-39458539 CCCACAATCCTTAGCGAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1023365395 7:39458545-39458567 GCTCCAGGCTGATGTGCTCGTGG 0: 1
1: 0
2: 0
3: 11
4: 165
1023365387_1023365395 17 Left 1023365387 7:39458505-39458527 CCGAAGTGAGCTCCCACAATCCT 0: 1
1: 0
2: 0
3: 18
4: 237
Right 1023365395 7:39458545-39458567 GCTCCAGGCTGATGTGCTCGTGG 0: 1
1: 0
2: 0
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023365395 Original CRISPR GCTCCAGGCTGATGTGCTCG TGG Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
905947491 1:41916414-41916436 GCCCCAGGCTGAGGCGCTCAGGG + Intronic
907488838 1:54795857-54795879 GCTCCAGCCTTATGTGGTCTTGG - Intronic
912645300 1:111386601-111386623 CCTCCAGGCTGAGGTGGTCCTGG - Intergenic
915249288 1:154577045-154577067 GCTCCAGTCTGTTCTGCTCATGG + Exonic
915495546 1:156280217-156280239 GCTCCTGCCTGATGTCCTCTGGG - Intronic
918011925 1:180594918-180594940 CCTCCAGCCTGAAGTGCTCTAGG + Intergenic
922286567 1:224175847-224175869 GCGCGAGGCTGTTGTGCTCCCGG - Intronic
922642133 1:227245036-227245058 ACTGCAGGCTGAAGTGCTCTGGG + Intronic
923634232 1:235679648-235679670 GCCCCAGGCTGGTGTGGTAGTGG - Intronic
1066156853 10:32687392-32687414 GCTTGAGGCTGATGTGATTGGGG + Intronic
1067546665 10:47196836-47196858 GCTCCAGGCTGCTGCCCACGTGG + Intergenic
1067714100 10:48673168-48673190 GCTCAAGGCTGATGAGCATGGGG - Intergenic
1069044048 10:63723871-63723893 GCTCCAGGCTCAGATGCCCGTGG - Intergenic
1069532619 10:69230344-69230366 GCTCCAGGCTGACGACCTCAGGG - Intronic
1075358500 10:121806661-121806683 GATCCAAGCTGATGTACTTGGGG + Intronic
1075686464 10:124368118-124368140 GCCCCAGGCTGTGGTCCTCGGGG - Intergenic
1078082001 11:8210949-8210971 GCTCCAGGCAGATGGGTTGGGGG + Intergenic
1078091070 11:8265034-8265056 GCTCCAGACAGATGTGTTGGAGG + Intronic
1081864453 11:46352040-46352062 GCTCCAGGCAGCTGGGCTGGGGG + Intronic
1083780955 11:64917027-64917049 GGTCCAGGCTGAGGTGCTCTTGG + Exonic
1084604545 11:70164924-70164946 CCTACAGGCTGCTGTGCTTGGGG - Intronic
1085455133 11:76661277-76661299 GAGCCAGGCTGAGGTGCTCCAGG + Exonic
1087133878 11:94694826-94694848 AATCCAGGCTGATGTGGTCATGG + Intergenic
1091277994 11:134365174-134365196 GCTCCACGCAGATGTGCCTGAGG - Intronic
1093005389 12:14045775-14045797 GCCCCAGGCTGAGGTGTTCCTGG + Intergenic
1094172589 12:27509329-27509351 GCTCCAGGCTGACTTCCTCCTGG + Intergenic
1095960943 12:47833848-47833870 GCTCCACGGTGTTGTGCTGGTGG - Intergenic
1096003101 12:48145663-48145685 GCTTCCGGGTGATGTGCTCCAGG - Exonic
1096574852 12:52546344-52546366 GCTTCAGGCTCATGAGCTCCTGG + Exonic
1096630229 12:52921674-52921696 GCTCCAGGCTGGAGGGCTGGAGG - Intronic
1100576889 12:95900137-95900159 TCTCCAGGCTGATGCACTGGAGG - Intronic
1100946326 12:99787996-99788018 ACTGCAGGCTGAAGTGCTCTGGG + Intronic
1106156310 13:27160657-27160679 TCTTCAGACTGATGTGCTCAGGG - Intronic
1106433673 13:29705680-29705702 GCTCCAGGCTTATTGGCTTGTGG - Intergenic
1106913538 13:34487998-34488020 CATCAAGGCTGATGTGCTGGGGG + Intergenic
1111056077 13:82952864-82952886 ACTCCAGACTGCTGTGCTGGTGG - Intergenic
1112366579 13:98760819-98760841 CCTCCAGGCTGAAGTTCTCCTGG - Intergenic
1113516906 13:110910372-110910394 GATCCAGGGTGATGTGCCCAAGG - Intronic
1114707112 14:24738307-24738329 GGTCCAGGCTGAGGTGGTCCAGG - Intergenic
1117161588 14:52995164-52995186 GCAGCAGGCTAATGTGCTCTGGG - Intergenic
1118726142 14:68630383-68630405 GCTCCAGGCTGACCTGCTGCAGG - Intronic
1121751613 14:96362862-96362884 GGTCCAGGCTGAGCTGCTCCAGG + Exonic
1122573237 14:102723086-102723108 GCCCCAGGCTCATCTGCTCTGGG - Intronic
1123121466 14:105918870-105918892 GCCCCAGGCTGAGGTGGTGGGGG - Intronic
1123404179 15:20010535-20010557 GCCCCAGGCTGAGGTGGTGGGGG - Intergenic
1123513518 15:21017181-21017203 GCCCCAGGCTGAGGTGGTGGGGG - Intergenic
1123578705 15:21697037-21697059 GGGCCAGGCCGATGTGCTCTAGG + Intergenic
1123615332 15:22139519-22139541 GGGCCAGGCCGATGTGCTCTAGG + Intergenic
1124062515 15:26307232-26307254 TATCCAGGCTGAGGTGCTCTTGG - Intergenic
1127706111 15:61548641-61548663 CCTCCAGGCTGCTATGCTCTTGG + Intergenic
1129244461 15:74271119-74271141 GCACCAGGGTGATGGGCACGAGG + Intronic
1202987575 15_KI270727v1_random:431282-431304 GGGCCAGGCCGATGTGCTCTAGG + Intergenic
1132747714 16:1443890-1443912 CCTCCAGGCTCAAGGGCTCGGGG + Exonic
1133924659 16:10182868-10182890 GCTCCGGGCTGGTGTGTTTGAGG + Intergenic
1136156094 16:28383259-28383281 GCTCCAGGTTGATGTGCAGGTGG + Exonic
1136206992 16:28732029-28732051 GCTCCAGGTTGATGTGCAGGTGG - Exonic
1137604923 16:49780957-49780979 GCTTCCGGCTGGTGTGCTGGTGG - Intronic
1142132272 16:88436521-88436543 TCTCCAGGCTGGGGGGCTCGGGG - Exonic
1142202157 16:88766466-88766488 GCACCAGGCTGGTGTGGCCGAGG + Intronic
1142519883 17:497444-497466 GCCCCAGGCTGATGTGGCCTGGG - Intergenic
1142693224 17:1619553-1619575 GCTCCACCCTGACGGGCTCGAGG - Intronic
1143413613 17:6728606-6728628 ACTGCAGGCTGAAGTGCTCTGGG + Intergenic
1143781601 17:9232222-9232244 CCCCCAGGCTGCTGTGCTGGAGG + Intronic
1145058918 17:19720235-19720257 GCTCCATGCTGAGATGCCCGTGG - Intergenic
1147041813 17:37725354-37725376 AAACCAGGCTGCTGTGCTCGTGG - Intronic
1148471944 17:47899787-47899809 GCTGCGGGCTGATGTGCTCTTGG + Intronic
1151216519 17:72580754-72580776 TCTCCAGGCTGTTGAGCTCAAGG - Intergenic
1151976623 17:77487251-77487273 GCTCGAGGGTGAAGTCCTCGGGG + Intronic
1152223486 17:79081985-79082007 GCGCCGGGCTGATGTGTACGTGG + Exonic
1152411178 17:80124012-80124034 GCTGCAGCCTGCTGAGCTCGGGG - Intergenic
1152639837 17:81444839-81444861 GGTCCAGGCTGCTGTACTTGGGG + Intronic
1157570423 18:48708766-48708788 GGTCCAGGGTGGTGTGCTGGGGG - Intronic
1158503764 18:58027664-58027686 CCTCCATGATCATGTGCTCGTGG - Intergenic
1159101332 18:63962495-63962517 GATCCAGGATGATGTGCTTTTGG - Intronic
1160731846 19:644805-644827 GCTCCAGGCTGTGGGGCTCTTGG - Intergenic
1160833108 19:1112438-1112460 GCTCCAAGGTCATGTGCACGCGG + Exonic
1161028183 19:2046251-2046273 GCTGCAGGAAGATGTGCTGGGGG - Exonic
1161687759 19:5711824-5711846 GCTCCCGGCTGAGGTGCTCATGG - Exonic
1162123421 19:8486153-8486175 GCTCCAGGCCCATGCGCTCGAGG - Exonic
1162379510 19:10323226-10323248 GCTGCAGGATGTTGGGCTCGGGG + Exonic
1162739278 19:12764941-12764963 GCTCCACGCTGCTGGGCTCTGGG + Intronic
1163703899 19:18801211-18801233 GCTCCAGCCTGCTGTGTTCCTGG - Intergenic
1166727919 19:45039832-45039854 GCTCCAGCCTTAAGTGCTCAGGG + Intronic
1168345667 19:55649125-55649147 GCTCCAGGCTGCCGTGGTTGGGG + Intronic
925269338 2:2591212-2591234 ACTGCAGGCTGAAGTGCTCTGGG + Intergenic
929446004 2:42001925-42001947 GATCCAGGCTGAACTGCTGGAGG - Intergenic
929703755 2:44188935-44188957 GATCAAGGCTGAAGTGCTTGGGG - Intronic
931638906 2:64364176-64364198 GCTTCAGTCTGATGTGGTGGAGG + Intergenic
932461194 2:71883052-71883074 GCCCCAGCCAGATGTGCCCGAGG - Intergenic
933984926 2:87582817-87582839 TCACCAGGCTGATTTGCTGGTGG - Intergenic
934774483 2:96928459-96928481 GCCCCGGGCTGACTTGCTCGTGG - Intronic
1171556080 20:26083506-26083528 GCTCCAGGCTGATGTTTACTGGG + Intergenic
1172006603 20:31822661-31822683 CCTCCAGGCTGAAGTGCCCTGGG + Intronic
1173132027 20:40402890-40402912 GGTCCAGGCTGAGGTCCTCAAGG - Intergenic
1175221812 20:57421509-57421531 GTTCCAGGGTGATGTGATTGGGG + Intergenic
1179105090 21:38392407-38392429 GGTCCAGGCTGATCTCCTGGGGG + Exonic
1179439374 21:41382447-41382469 TCTCCAGGCTGATGAGCTCATGG - Exonic
1179724398 21:43333753-43333775 GCTCCACGCTGCTGGGCTCACGG - Intergenic
1181997640 22:26895457-26895479 TCTCAAGGTTGATGTGCTAGTGG + Intergenic
1183271781 22:36866786-36866808 GCTCAAGGCAGATGTTCTGGAGG - Intronic
1183424964 22:37734520-37734542 GGTCCTGGCTGATGTCCTGGGGG - Exonic
1184188939 22:42882144-42882166 CTTCCAGGCTGATGAGCTCATGG + Intronic
950100077 3:10351291-10351313 GCTCCAGGCTGGTTTCCTCGGGG - Intronic
951616805 3:24556294-24556316 GCTGCTGGCTGAGATGCTCGGGG + Intergenic
956279354 3:67540316-67540338 ACTTCAGACTGATGTGCTGGCGG - Intronic
959336002 3:105066175-105066197 GCCTCAGGCTGAAGTGCTCTGGG + Intergenic
961547484 3:127645376-127645398 TCTCCATCCTGATGTGCTAGTGG + Intronic
961695115 3:128698789-128698811 GCTCCGGGCTGCTGTTGTCGGGG - Intergenic
962274494 3:134001743-134001765 GTTCCAGGCTGATGTGAGAGAGG + Intronic
963798672 3:149656859-149656881 GCTCCAGGCTGACTTACTTGAGG + Exonic
966822105 3:183933263-183933285 GCACCAGGCAGAAGTGCTCCGGG + Intronic
967207871 3:187139802-187139824 GTTCCTGGCTCGTGTGCTCGCGG - Intronic
971010592 4:22430377-22430399 GGTCCAGGCTGAGGTGGTCTGGG + Intronic
980692943 4:136319821-136319843 GCCACAGGCTGAAGTGCTCTGGG + Intergenic
984192304 4:176620231-176620253 GCTCCAGCCTGAGGAGCTAGTGG - Intergenic
987071208 5:14338629-14338651 GGTCCAGGCTGCTGTGCTCCTGG - Intronic
993791766 5:92218725-92218747 GGTCCAGGCTGCTGTGCAAGTGG + Intergenic
995994755 5:118284277-118284299 GCTCCAGTCTGGTGTGCAAGTGG - Intergenic
997211120 5:132077475-132077497 GCTCCTGGCTCATGTGCTCTGGG + Intergenic
997714189 5:136029658-136029680 GCCCCAGGCTCCTGTGCTCCTGG + Intronic
998039803 5:138944934-138944956 GCGCCAGGCTGCTGAGCCCGAGG - Intergenic
998254462 5:140573994-140574016 GCTCCAGGCTGCTCTGTTGGGGG - Intronic
1003193104 6:3891356-3891378 GGTCCAGGGTGATGTGCTGCAGG - Intergenic
1003631968 6:7795394-7795416 GCTCCAGGCTGAGGGGATGGAGG + Intronic
1005495080 6:26381411-26381433 GCTCCTGCCTGAAGTGCTCTCGG - Intergenic
1006450392 6:34102678-34102700 GCCCCAGGCTGATGTTTTAGAGG - Intronic
1009532790 6:64842603-64842625 GGTCCAGGCTGAGGTGGTCTCGG + Intronic
1016002908 6:139060566-139060588 GCTACAGGCTGCTGTGGTCTAGG + Intergenic
1017286958 6:152686393-152686415 GTTCCAGGCTTATGTGTTGGGGG + Intergenic
1017959474 6:159209247-159209269 GCTCCAGGCTTCTGGGCTGGGGG + Intronic
1018050906 6:160006615-160006637 GCACCAGGCTGATGGCCCCGTGG - Intronic
1019088862 6:169507499-169507521 GCTTCTGGCTGATATGCTCCAGG - Intronic
1019140662 6:169940380-169940402 GCCCCAGGCTGAAGTACTGGGGG + Intergenic
1019272837 7:160054-160076 GCTCCAGGCAGGTGTGCACAGGG - Intergenic
1019460901 7:1158732-1158754 ACTCCAGGTTGATGTCATCGAGG - Intronic
1019524871 7:1476398-1476420 CCACCAGGCTGATGAGCTCCGGG + Exonic
1019692841 7:2426272-2426294 GAGCCAGGCTGATGTGATGGGGG + Intronic
1021214707 7:17901433-17901455 ACTGCTGGCTAATGTGCTCGGGG - Intronic
1022472538 7:30690695-30690717 GCTCCAGGCTGACGTGGTGAGGG - Intronic
1023365395 7:39458545-39458567 GCTCCAGGCTGATGTGCTCGTGG + Intronic
1023834276 7:44059263-44059285 CCTCCACCCTGGTGTGCTCGAGG - Intronic
1024108246 7:46115992-46116014 GCTCCAGGCTAACATGCTCCAGG + Intergenic
1027829193 7:83155679-83155701 TGTCCAGGCTGCTGTGCTGGAGG + Exonic
1028145879 7:87319392-87319414 ACCCCAGACTGCTGTGCTCGCGG + Intergenic
1029608409 7:101613818-101613840 GCCCCAGGTTGATGTCCTCCTGG - Intronic
1035300870 7:157896492-157896514 CCTCCAGGCTCAGGTGCGCGTGG + Intronic
1035326933 7:158071447-158071469 GCTCGTGGTTGAGGTGCTCGTGG + Intronic
1035326963 7:158071594-158071616 GCTCCTGGTGGAGGTGCTCGTGG + Intronic
1037674339 8:21041197-21041219 TCTCCAGGCTGAAGGGCTGGAGG - Intergenic
1037855979 8:22370869-22370891 CCTCCAGGCTGGTGGGCTGGTGG + Intronic
1045112589 8:98948646-98948668 GCCCCGGGCTGATCTGCACGCGG + Intronic
1045996216 8:108365214-108365236 TCGCCAGGCTGATGTGATCTCGG + Intronic
1046969981 8:120212080-120212102 GCTCCAGGCCAGTGTGCTGGAGG - Intronic
1047913560 8:129557243-129557265 GCTCTAGGCTGAAGTGCTTCTGG + Intergenic
1048923274 8:139249667-139249689 GGTCCAGGCTGAGGTGGTCTTGG + Intergenic
1051345903 9:16151138-16151160 GCTCCAGGCTGTCTTGCTGGAGG - Intergenic
1051982901 9:23045961-23045983 ACTCCAGACTGCTGTGCTGGCGG - Intergenic
1052537201 9:29761977-29761999 GCTCCAGGCTGGTGTACTGGGGG - Intergenic
1056442217 9:86632602-86632624 ACTCCTGGGTGATGTTCTCGGGG + Intergenic
1056607004 9:88094138-88094160 GCTCCAGGTTCCTGTGCTTGAGG + Intergenic
1057354687 9:94323506-94323528 GCTCTGGGCTGCTGGGCTCGTGG + Intronic
1057499805 9:95587652-95587674 GCTCCATGCTCATGTGCCCCAGG - Intergenic
1057653071 9:96934129-96934151 GCTCTGGGCTGCTGGGCTCGTGG - Intronic
1061282765 9:129607016-129607038 GCTCCCGGCTGCCGTGCTTGGGG + Intergenic
1062291469 9:135797156-135797178 GCTCCTGGCTGCTGTCCTCTGGG - Intergenic
1189165700 X:38858749-38858771 GCTGCAGGCTGAGGTCATCGGGG - Intergenic
1189670922 X:43407940-43407962 GCTCCAGGTTGAATTGCTCCAGG + Intergenic
1191873765 X:65773015-65773037 GCTCCAGGTTGAATTGCTCTAGG + Intergenic
1193254033 X:79325540-79325562 ACTTCAGGCTGCTGTGCTGGCGG + Intergenic
1195095980 X:101501514-101501536 GCTCCAGGCTGCTTTGCCTGTGG - Intronic
1195321927 X:103727718-103727740 GCTCCATCCTGATGTGGTCTTGG + Intronic
1197653019 X:129086339-129086361 GCTCCAGGCAGATCTGATCCAGG - Intergenic
1198173615 X:134132172-134132194 ACTCCAGGCTGGTGTGGTCTGGG + Intergenic
1198304741 X:135369235-135369257 AGTCCAGGCTGAGGTGGTCGTGG - Intergenic
1199973840 X:152879848-152879870 GCACCAGGCAGATCTGCTCCTGG + Intergenic