ID: 1023367243

View in Genome Browser
Species Human (GRCh38)
Location 7:39475932-39475954
Sequence CCCAGAAAGTTCCTACTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 5, 3: 70, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023367237_1023367243 25 Left 1023367237 7:39475884-39475906 CCTGGTGCCCTTCCTGGGTCATC 0: 1
1: 0
2: 1
3: 24
4: 255
Right 1023367243 7:39475932-39475954 CCCAGAAAGTTCCTACTCCCTGG 0: 1
1: 0
2: 5
3: 70
4: 282
1023367238_1023367243 18 Left 1023367238 7:39475891-39475913 CCCTTCCTGGGTCATCAGCTTTT 0: 1
1: 0
2: 0
3: 31
4: 298
Right 1023367243 7:39475932-39475954 CCCAGAAAGTTCCTACTCCCTGG 0: 1
1: 0
2: 5
3: 70
4: 282
1023367239_1023367243 17 Left 1023367239 7:39475892-39475914 CCTTCCTGGGTCATCAGCTTTTC 0: 1
1: 0
2: 1
3: 24
4: 259
Right 1023367243 7:39475932-39475954 CCCAGAAAGTTCCTACTCCCTGG 0: 1
1: 0
2: 5
3: 70
4: 282
1023367240_1023367243 13 Left 1023367240 7:39475896-39475918 CCTGGGTCATCAGCTTTTCTTGA 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1023367243 7:39475932-39475954 CCCAGAAAGTTCCTACTCCCTGG 0: 1
1: 0
2: 5
3: 70
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023367243 Original CRISPR CCCAGAAAGTTCCTACTCCC TGG Intronic
900871480 1:5307203-5307225 TCCAGGAAGTGCCCACTCCCAGG + Intergenic
903657874 1:24959947-24959969 CCCAGGACGTTCCTTCTGCCTGG + Intronic
904529246 1:31157319-31157341 CCCTGCAAGTTCCACCTCCCGGG + Intergenic
907288142 1:53395413-53395435 CCCAGAAAGTGGCAACTCCTGGG + Intergenic
907318952 1:53590826-53590848 TCCAGCAAGTCCCTAGTCCCAGG + Intronic
907485450 1:54774863-54774885 CTCAGAATTATCCTACTCCCAGG + Intergenic
907846258 1:58210562-58210584 TCCAGACAATTCCTACTGCCAGG + Intronic
909672238 1:78202603-78202625 CCCAGAAATGTCCTAATCCTTGG - Intergenic
909804555 1:79858445-79858467 CCTGGAAAGTTGCTTCTCCCTGG + Intergenic
909912368 1:81276815-81276837 ACCAGAAAGTTCCTGTTGCCTGG - Intergenic
910631008 1:89354305-89354327 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
913410908 1:118550212-118550234 CCCAGGAAGCTCCGCCTCCCAGG - Intergenic
914172147 1:145234577-145234599 CCCAGCAAGCTCCTCCTCCTTGG - Intergenic
915642441 1:157239242-157239264 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
915976965 1:160397845-160397867 CCCAGGAGGGTCCAACTCCCAGG + Intergenic
918984772 1:191609369-191609391 CCCAGGAAGTTGCTTCTTCCTGG + Intergenic
921619203 1:217307973-217307995 CACAGCAAGTTCCGCCTCCCAGG - Intergenic
922813788 1:228434446-228434468 CCCAGGAAATTCTTACTCTCAGG + Intergenic
923179665 1:231504230-231504252 CACTGCAAGTTCCTCCTCCCGGG + Intergenic
923511898 1:234660137-234660159 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
924226828 1:241928777-241928799 CACAGCAAGTTCCGCCTCCCAGG - Intergenic
1063654978 10:7979266-7979288 CACAGAAAGCTCCGCCTCCCAGG - Intronic
1067111118 10:43401004-43401026 CCCTGCAAGTTCCGCCTCCCGGG - Intronic
1067577912 10:47419551-47419573 CCCAGCAGGCTCCTCCTCCCAGG - Intergenic
1067959569 10:50833230-50833252 CCCAGGATGCTACTACTCCCAGG - Intronic
1069226163 10:65947605-65947627 TCCAGAAAGTACATAATCCCTGG + Intronic
1070709054 10:78664276-78664298 CCCAGACTGTCCCTACCCCCAGG - Intergenic
1072172440 10:92878619-92878641 CCCAGGAAGTTGCTTCTTCCTGG + Intronic
1072481797 10:95816108-95816130 CCCAGGAAGTTGCTTCTCCCTGG + Intronic
1073177015 10:101562826-101562848 CACGGAAACTTCCTACTCCCGGG - Intergenic
1073532359 10:104244201-104244223 CCCAGAAAGTTGCTTCTCTCTGG + Intronic
1073909584 10:108325891-108325913 TCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1074287356 10:112110651-112110673 CCCAGGAAGTTTCTTCTCCCTGG + Intergenic
1077414780 11:2420025-2420047 CCCAGACAGCTCCTCCTCCCAGG + Intronic
1078281317 11:9903891-9903913 CCCAGGAAGTTGCTTCTCCCTGG + Intronic
1079557826 11:21782766-21782788 CCCAGAAAGTTTATTCTCGCTGG + Intergenic
1079589730 11:22167559-22167581 CCCAGAAATTTGCTTCTCCCTGG + Intergenic
1079598497 11:22283860-22283882 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1079894569 11:26102634-26102656 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1080439064 11:32273703-32273725 ACCAGAAAGTTTCTTCTTCCAGG + Intergenic
1080840813 11:35981940-35981962 CCCAAAGAGCTCCGACTCCCAGG - Intronic
1080867209 11:36205900-36205922 GCCTGGAAGTTCCTGCTCCCTGG + Intronic
1081159068 11:39731664-39731686 CCCAGGAAGTTCCCTCTCTCTGG + Intergenic
1082187627 11:49203972-49203994 CCCAGGAAGTTGCTTCTCCCTGG - Intronic
1083311633 11:61786736-61786758 CCCAGGAGGTTTCTTCTCCCTGG + Exonic
1083422917 11:62565780-62565802 AGCTGAAAGTTCTTACTCCCGGG - Intronic
1084188201 11:67486466-67486488 CCTAGAAAGTTCCTATCCCAGGG + Intronic
1084437924 11:69155000-69155022 CCCAGGAAGTTCCCTCCCCCAGG - Intergenic
1084537661 11:69767094-69767116 CACTGAAAGCTCCTCCTCCCGGG - Intergenic
1084842319 11:71865207-71865229 CACTGCAAGTTCCTCCTCCCGGG + Intergenic
1086467765 11:87073109-87073131 CACTGAAACCTCCTACTCCCTGG + Intronic
1086533200 11:87811253-87811275 CCCAGGAATTTTCTTCTCCCTGG + Intergenic
1086678692 11:89641413-89641435 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1089109796 11:116046367-116046389 CACAGAAAGTGCTTACTCTCAGG + Intergenic
1089891958 11:121890418-121890440 CCCTGAATGTTCCTCCTGCCTGG - Intergenic
1090507752 11:127337635-127337657 CACTGAAAGCTCCTCCTCCCAGG + Intergenic
1091757883 12:3067135-3067157 CCCAGGAAGCTGCTTCTCCCTGG - Intergenic
1094737745 12:33254272-33254294 CCCAGGAAGTTTCTGCTTCCTGG + Intergenic
1097051246 12:56224518-56224540 GCCAGTAAGATTCTACTCCCTGG + Exonic
1097315529 12:58167051-58167073 CCCAGGAAGTTGCTTCTCACTGG + Intergenic
1098437236 12:70480942-70480964 TCCATAAACTTCCTGCTCCCTGG - Intergenic
1098584692 12:72141995-72142017 CCCAGGAAATTTCTTCTCCCTGG - Intronic
1098901921 12:76119473-76119495 CACAGGAAGTTGCTTCTCCCTGG - Intergenic
1099580411 12:84439537-84439559 CCCAGAAAGATTATACTCTCTGG + Intergenic
1100609761 12:96181626-96181648 CCCTGCAACTTCCAACTCCCTGG - Intergenic
1101634496 12:106527227-106527249 CCCAGAAACTTCTCACTCTCAGG - Intronic
1102311434 12:111847751-111847773 GCTAGAAAGTTCCTTCTGCCTGG + Intronic
1102917290 12:116763701-116763723 CACTGCAAGTTCCAACTCCCAGG - Intronic
1103522931 12:121548502-121548524 CCCCGAAAATGCCCACTCCCAGG + Intronic
1103610932 12:122123929-122123951 CCCACACAGTTCCTTCTGCCTGG - Intronic
1104364027 12:128160754-128160776 TCCAGAATCCTCCTACTCCCTGG - Intergenic
1109164361 13:59015339-59015361 CCCAGAAACTTCCTTCTACAGGG - Intergenic
1109959595 13:69613274-69613296 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1110079490 13:71292500-71292522 CCCAGTAAGTTGCCTCTCCCTGG + Intergenic
1110877521 13:80528156-80528178 CCCAGAAAGTTTCTTCTCCCAGG - Intergenic
1110952459 13:81513971-81513993 CCCAGAAAGTTGCTTTTCCCTGG - Intergenic
1111346362 13:86959600-86959622 TCCACAAATTTCCTACACCCAGG - Intergenic
1111585983 13:90285138-90285160 CCCTGCAAGTTCCGCCTCCCGGG + Intergenic
1112020562 13:95367625-95367647 CCCAGGAAGTTTCTTCTCCCGGG + Intergenic
1112155755 13:96815393-96815415 CCAAGAAAGGTCATATTCCCAGG + Intronic
1113669633 13:112166836-112166858 CACAGAAAGTCCTTAGTCCCTGG + Intergenic
1114281400 14:21195567-21195589 ACCAGGAAGTTGCTTCTCCCTGG - Intergenic
1116845848 14:49864206-49864228 CCCTGAACGTTTCTTCTCCCTGG + Intergenic
1117282701 14:54256249-54256271 CTCAGGAAGTTTCTTCTCCCTGG - Intergenic
1119138129 14:72239360-72239382 CCCAGGAAGTTGCTTCTCCCTGG + Intronic
1119139626 14:72254633-72254655 TCTAGAAAGTTCCTATTCACAGG + Intronic
1119298354 14:73551477-73551499 CCCAGGAAGTTGCTTCTCCCTGG - Intronic
1119302647 14:73583669-73583691 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1121500171 14:94429290-94429312 TCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1121844754 14:97163272-97163294 CCCTGAAAGCTCCACCTCCCGGG + Intergenic
1123506247 15:20942792-20942814 CCTACAAAGCTCCTACTACCTGG - Intergenic
1123563473 15:21516496-21516518 CCTACAAAGCTCCTACTACCTGG - Intergenic
1123599725 15:21953782-21953804 CCTACAAAGCTCCTACTACCTGG - Intergenic
1124014907 15:25865905-25865927 CACAGTAAGTTTCTGCTCCCCGG + Intergenic
1124136457 15:27039940-27039962 CCCAGGAAGTTCCTCCTTGCTGG + Intronic
1125896627 15:43308023-43308045 CCCAGGAAGCTCCGCCTCCCAGG + Intergenic
1125920820 15:43524655-43524677 AAGAGAAAGTTCCTCCTCCCAGG + Exonic
1126365163 15:47886605-47886627 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1127371387 15:58345093-58345115 TCCAGGAAGTTTCTTCTCCCTGG - Intronic
1127406012 15:58647334-58647356 CCCAGCAAGCTCCGCCTCCCGGG + Intronic
1128400915 15:67279938-67279960 CACTGAAAGTTCCGCCTCCCGGG - Intronic
1128529443 15:68433706-68433728 CCTACAAAGTTCCTTGTCCCAGG - Intergenic
1129452190 15:75657348-75657370 CCTTGAAAGCTCCTTCTCCCAGG - Exonic
1129458122 15:75686536-75686558 CCCGGAATGTTCCTTCTGCCTGG + Intronic
1129607912 15:77033760-77033782 CCCTGGAACTTCCTACTCCTGGG + Intronic
1129725664 15:77900346-77900368 CCCGGAATGTTCCTTCTGCCTGG - Intergenic
1131163758 15:90127641-90127663 CCCTGCAAGCTCCTCCTCCCAGG + Intergenic
1131590889 15:93747120-93747142 CCCAGACAATTCCTCCTCACTGG + Intergenic
1202971831 15_KI270727v1_random:243633-243655 CCTACAAAGCTCCTACTACCTGG - Intergenic
1134605956 16:15571431-15571453 CACAGCAAGTTCCGCCTCCCGGG + Intronic
1135282531 16:21165070-21165092 CCCAGAAATTGTCTTCTCCCAGG - Intronic
1135375999 16:21947947-21947969 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1136470933 16:30479604-30479626 CCTAGAAGCTTTCTACTCCCTGG - Intronic
1137541363 16:49364363-49364385 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1138201547 16:55092054-55092076 CCTGGAAAGTCCCTACTCTCTGG - Intergenic
1138995855 16:62452140-62452162 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1140221811 16:73048991-73049013 CCCAGGGAGTTCCTACCGCCAGG + Intronic
1140536195 16:75712024-75712046 CCCTGGAAGTTGCTCCTCCCTGG - Intronic
1141304550 16:82849424-82849446 CACTGAAACCTCCTACTCCCTGG - Intronic
1141469027 16:84226047-84226069 CCCAGAAAGTTCCGGGTCCTAGG + Intronic
1143182938 17:4995127-4995149 CACTGCAACTTCCTACTCCCTGG - Intronic
1143338517 17:6191415-6191437 CCCAGGTAGTTCCCACTCCCAGG + Intergenic
1143834711 17:9681839-9681861 CCCAGATGATTCCTACGCCCTGG + Intronic
1143999461 17:11039373-11039395 CCCACCTAGTTCCTGCTCCCAGG + Intergenic
1144003483 17:11077028-11077050 CACAGCAACTTCCTCCTCCCGGG - Intergenic
1144009427 17:11132478-11132500 CCCAAAGAGTTCCTGTTCCCAGG - Intergenic
1144009947 17:11137557-11137579 CTCAGAAAGTCCCTGTTCCCAGG - Intergenic
1144024967 17:11269534-11269556 CCCAGAGAGTCCCTGTTCCCAGG + Intronic
1146144766 17:30404092-30404114 CCCAGAAGGTTCCCAGACCCTGG - Intronic
1148152359 17:45404357-45404379 CCCACCAAGTCCCTCCTCCCAGG + Intronic
1148741453 17:49895292-49895314 CTCAGTAAGCTCCTTCTCCCAGG - Intergenic
1148847002 17:50535194-50535216 CCCAGACTGTTCCTACTCTCAGG + Intronic
1148899796 17:50866829-50866851 CCCAGAAAGTGCCCTCTCCGCGG + Intronic
1149827918 17:59846651-59846673 CACAGAAAGATCCTCCTCCCTGG - Intergenic
1150279102 17:63918603-63918625 CTCAGAAAGCTCCTGGTCCCTGG - Intronic
1150452361 17:65279450-65279472 CACTGCAAGTTCCAACTCCCCGG - Intergenic
1152618661 17:81349871-81349893 CCCAGAAAGTTGGGACTCCCAGG + Intergenic
1153148276 18:2058207-2058229 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1153416466 18:4851049-4851071 GCCAAAAATTTCCTGCTCCCTGG - Intergenic
1156297242 18:35803869-35803891 CACAGAAAGTTCCAACTCTAGGG + Intergenic
1156352341 18:36311946-36311968 TCCAGAAAGTCCCTCTTCCCTGG + Intronic
1156449038 18:37256172-37256194 CTCAGAAGGTTTCTGCTCCCAGG + Intronic
1158915971 18:62129842-62129864 CCCAAAAAGGTCCTAACCCCTGG + Intronic
1159758711 18:72398148-72398170 CCCAGGAGATTCCTACTCCTTGG + Intergenic
1159891250 18:73955283-73955305 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1161283797 19:3458808-3458830 TCCAGAAAGTTCTGACTCCCAGG - Intronic
1161746853 19:6065569-6065591 CCCAGGAAGCTCCGCCTCCCGGG - Intronic
1161828375 19:6585060-6585082 CCCTGAAACTTCCGCCTCCCAGG + Intronic
1163430817 19:17266274-17266296 CCCAGGAAGTTCCTTCTGCCTGG - Intronic
1163553481 19:17979355-17979377 CACTGCAAGCTCCTACTCCCGGG - Intronic
1164479446 19:28600094-28600116 CCCATTGAGTTCCTTCTCCCGGG - Intergenic
1164923948 19:32111234-32111256 CACTGCAAGTTCCTCCTCCCTGG - Intergenic
1166637210 19:44460933-44460955 TCCTCAAAGTCCCTACTCCCTGG - Intergenic
1166721434 19:44998886-44998908 CACTGCAAGCTCCTACTCCCGGG - Intergenic
925165853 2:1715197-1715219 CCCAGAAAGACCCTGCTCCGGGG + Intronic
925167862 2:1729541-1729563 CCCAGAATGTTCCTACAGCAGGG + Intronic
925810266 2:7693502-7693524 CCGAGAAAGTTCATACCCCAGGG + Intergenic
925916105 2:8607495-8607517 TCCAGCAAGTTCCTTCTCCCAGG + Intergenic
932090578 2:68802330-68802352 CACTGAAACTTCCTTCTCCCGGG - Intronic
932567870 2:72920850-72920872 CCCGGAAAGTTCCTGATCTCGGG - Intronic
932964328 2:76454063-76454085 CCCAGGAAGTCTCTTCTCCCTGG - Intergenic
934523176 2:95032589-95032611 CCCAGAACGTTCCTGCTTCAAGG - Intronic
935710119 2:105890932-105890954 CCCAGAAACTTCCTGCTCTGAGG - Intronic
936157735 2:110059706-110059728 CCCAGGAAGTTTCTTCTCACTGG + Intergenic
936186957 2:110311738-110311760 CCCAGGAAGTTTCTTCTCACTGG - Intergenic
936475691 2:112837822-112837844 CCCTGCAAGTTCCGCCTCCCGGG + Intergenic
937227118 2:120376286-120376308 GCCAGAAAGTCCCTCGTCCCTGG - Intergenic
937461727 2:122094594-122094616 CCCAGCAAGTTCCGCCTCCCAGG - Intergenic
939476479 2:142694114-142694136 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
940710377 2:157155481-157155503 CCCAAAAAGTTGCTTCTCCCTGG - Intergenic
941987327 2:171522408-171522430 CCCAGAAAGTCCCTCCCCGCAGG + Exonic
942109331 2:172664492-172664514 CCCAGAAGGATCATACTCCAAGG - Intergenic
943249274 2:185496123-185496145 CCCAGGAAGTTTTTTCTCCCTGG + Intergenic
943922908 2:193732297-193732319 CACTGAAAGTTCCGCCTCCCAGG - Intergenic
944872949 2:203932736-203932758 CCCAGGAAGTTGCTTCTACCTGG - Intergenic
945592506 2:211751730-211751752 ACCAGAAAGTTCTTACAACCTGG + Intronic
947154851 2:227152161-227152183 CCCAGACAGTTCTTACACCCTGG + Intronic
947500489 2:230667628-230667650 CACAGAAAGTACCTTGTCCCAGG - Intergenic
947602879 2:231465173-231465195 GCCAGAAAGTTACTTCTCCGAGG - Intronic
948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG + Intronic
1171983071 20:31640505-31640527 CCCATGCAGTTCCCACTCCCTGG - Intronic
1172192529 20:33070605-33070627 CCAGGAAAGTCCCTACTGCCAGG - Intronic
1173844594 20:46179895-46179917 CTCATAAAGTTCCTGCTCTCTGG + Intronic
1173971450 20:47155717-47155739 CCCAGAAAGATCCCTTTCCCAGG + Intronic
1174536767 20:51257414-51257436 CCCAGGAAGTTTCTTCTCCCTGG - Intergenic
1175311242 20:58012914-58012936 TCCAGAAAGTTCCTGCTCAATGG - Intergenic
1176658399 21:9610598-9610620 CACTGAAACTTCCTCCTCCCAGG + Intergenic
1177889824 21:26791822-26791844 CACAGAAAGCTCCGCCTCCCAGG + Intergenic
1178050996 21:28747204-28747226 CCCAGAAACTTTCTCCTCCCAGG - Intergenic
1179081259 21:38172710-38172732 CCCTGCAAGTTCCACCTCCCGGG + Intronic
1179643348 21:42761090-42761112 TCCTGAAAGTTCCTACTCCGGGG - Intronic
1181452805 22:23035204-23035226 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1181728749 22:24829827-24829849 ACCATAAAGTTCCTACACACAGG + Intronic
1182055369 22:27349369-27349391 CCCAGGGAGTTGCTTCTCCCTGG + Intergenic
1183474423 22:38028063-38028085 CACCGAAAGTCCCTGCTCCCTGG + Intronic
950218028 3:11173476-11173498 CACTGCAAGTTCCTCCTCCCGGG + Intronic
950486817 3:13278741-13278763 CACTGAAAGTTCCGCCTCCCAGG - Intergenic
950494466 3:13325495-13325517 CCCAGGAAGTGCCCACTCCGGGG + Intronic
951138376 3:19130967-19130989 CCCAGGAAGATGCTTCTCCCTGG - Intergenic
951953417 3:28226894-28226916 CTTAGAAAGTCCTTACTCCCAGG - Intergenic
952147737 3:30551404-30551426 CCCAGGAAGTTGCTTCCCCCTGG + Intergenic
952297937 3:32077494-32077516 CCCAGGAAGCTGCTTCTCCCTGG - Intronic
953125063 3:40084059-40084081 CCCTGCAAGTTCCGCCTCCCGGG - Intronic
953310659 3:41875101-41875123 CACTGAAAGTTCATACTCCTGGG - Intronic
955685069 3:61541093-61541115 CACTGCAAGTTCCTCCTCCCAGG - Intergenic
957439245 3:80221976-80221998 CACAGAAAGCTCCACCTCCCGGG + Intergenic
959383126 3:105666608-105666630 CCCAGCAATTTCCACCTCCCAGG - Intronic
959445390 3:106433266-106433288 CACAGCAAGCTCCGACTCCCGGG + Intergenic
960246000 3:115400973-115400995 CTCAGAAAGTTGCTTTTCCCTGG - Intergenic
961323738 3:126097310-126097332 CCCAGGAAGTTGCTTCTCCCTGG + Intronic
962562725 3:136624172-136624194 CACTGCAAGTTCCAACTCCCGGG + Intronic
965000147 3:162942903-162942925 CCCAGGAAGTTTCTTCTCCCTGG - Intergenic
965392338 3:168120191-168120213 CACTGCAAGCTCCTACTCCCGGG + Intergenic
966099760 3:176252917-176252939 CCCTGCAACTTCCAACTCCCCGG - Intergenic
966206925 3:177414419-177414441 CCCAGCATGCTCCTACTCCCTGG + Intergenic
966559879 3:181308388-181308410 CCCTGAAAGTTTCTTCTCTCTGG - Intergenic
966782454 3:183595458-183595480 CCCGGGAAGTTGCTTCTCCCTGG - Intergenic
967218516 3:187229815-187229837 CCCAGAAAGGCACCACTCCCTGG - Intronic
971572522 4:28231459-28231481 CCCAGGAAGTTGTTTCTCCCTGG + Intergenic
973930557 4:55789404-55789426 CCCAGGAAGTTCCTTCTCCCTGG + Intergenic
974664283 4:64937633-64937655 CCCAGGAAGTTGTTTCTCCCTGG + Intergenic
974691278 4:65300450-65300472 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
975100984 4:70512748-70512770 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
975765799 4:77666606-77666628 CACTGAAAGCTCCTCCTCCCGGG + Intergenic
975908548 4:79244080-79244102 ACCAGGAAGTTACTTCTCCCTGG + Intronic
975986627 4:80206829-80206851 CCCAGAAGATTCCGACTCCCTGG + Intergenic
977104123 4:92858631-92858653 CCCTGCAAGCTCCGACTCCCAGG + Intronic
977720833 4:100238528-100238550 CCCAGGAAATTGCTTCTCCCTGG - Intergenic
979125757 4:116969763-116969785 CCCAGGAATTTGCTTCTCCCTGG + Intergenic
979769753 4:124508195-124508217 CCCAGGAAGTTGCTTCTCTCTGG - Intergenic
981847849 4:149189792-149189814 CACTGAAAGCTCCTCCTCCCAGG - Intergenic
982825288 4:159996540-159996562 CACTGCAAGTTCCTCCTCCCAGG - Intergenic
983009717 4:162532307-162532329 TCCAGGAAGTTGCTTCTCCCTGG - Intergenic
983184209 4:164682440-164682462 CCCAGGAAGTTGCTCCTCCTTGG + Intergenic
985345987 4:189004761-189004783 CACTGAAACTTCCTTCTCCCGGG - Intergenic
985417014 4:189745480-189745502 CACTGAAACTTCCTCCTCCCAGG - Intergenic
986219176 5:5752114-5752136 CCCAGGAAGTTACTTCTCCCAGG - Intergenic
986650507 5:9959024-9959046 TCCAGGAAGTTGCTTCTCCCTGG + Intergenic
986659877 5:10049635-10049657 CCCTGTAAATTCCAACTCCCTGG - Intergenic
986751586 5:10792616-10792638 CTCAGGAAGTTGCTTCTCCCTGG - Intergenic
986954572 5:13135650-13135672 CCTAGGAAGTTTCTTCTCCCTGG - Intergenic
987340497 5:16935672-16935694 CCCAGAAAGTTGCGCCTTCCAGG + Intronic
987624326 5:20378245-20378267 CCCTGAAAGCTCCGCCTCCCGGG + Intronic
987664774 5:20923077-20923099 CCCAGGAAGTTTCTTCTCCCTGG - Intergenic
987857793 5:23443770-23443792 CACTGAAACTTCCTCCTCCCAGG + Intergenic
988757914 5:34279091-34279113 CCCAGGAAGTTTCTTCTCCCTGG + Intergenic
988915605 5:35891064-35891086 CCCAGGAAGTTCCTTCTCCTTGG - Intergenic
989230781 5:39084517-39084539 CACCGCAAGTTCCTCCTCCCAGG + Intergenic
989268064 5:39500414-39500436 CCCAGATAGTTCCCATTGCCTGG + Intergenic
989634123 5:43516303-43516325 CCCAGGAAGTTGCTTCTCTCTGG - Intergenic
989819939 5:45784837-45784859 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
990341091 5:54823687-54823709 CCCGGGAAGTTTCTTCTCCCTGG - Intergenic
990521307 5:56584094-56584116 CCCAGGAAGTTGCTTCTCCCTGG + Intronic
990607810 5:57427903-57427925 CCCAGAAGGTGCTAACTCCCTGG + Intergenic
993393083 5:87345142-87345164 CTTATAAAGTTCCTACTCCTAGG - Intronic
994535636 5:101026164-101026186 CCCAGGAAGTGGCTTCTCCCTGG - Intergenic
995594661 5:113734896-113734918 CCCAGAAAGTTGCTTCTCCTTGG - Intergenic
996213471 5:120839900-120839922 TCCAGGAAGTTGCTTCTCCCAGG - Intergenic
996582198 5:125043971-125043993 CCCAGAATGTGTCTCCTCCCGGG + Intergenic
997202212 5:132017865-132017887 AGCAGAGAGTTCCTCCTCCCGGG + Intergenic
997422275 5:133779022-133779044 CCCACAGAGGTCCTACTCCATGG - Intergenic
998817680 5:146030505-146030527 CCCAGCAAGCGCCTAATCCCGGG - Intronic
999822932 5:155246918-155246940 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
999953964 5:156680278-156680300 ACCAGAAAGTACCCAGTCCCGGG - Intronic
1003201493 6:3965325-3965347 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1004695142 6:18026475-18026497 CACTGCAAGTTCCTCCTCCCGGG + Intergenic
1005535764 6:26754763-26754785 CCCAGAAAGTTACGTCGCCCAGG + Intergenic
1008457497 6:51727743-51727765 CCCAGGAAGTTGCTTCTTCCTGG + Intronic
1009521064 6:64682486-64682508 CCCAGGAAGTTGCATCTCCCTGG - Intronic
1010010384 6:71041631-71041653 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1010549868 6:77208248-77208270 TCCAGCAAGTTCCCACTTCCTGG - Intergenic
1010562864 6:77372004-77372026 CCCAGGACGTTTCTTCTCCCTGG + Intergenic
1011294266 6:85809596-85809618 CCCAGGAACTTGCTTCTCCCTGG - Intergenic
1013371067 6:109471529-109471551 CCCTGAGGGTTCCTACTCACAGG - Intronic
1013865574 6:114692303-114692325 ACCATAAAGTTCCTATTCACAGG - Intergenic
1014568232 6:122977492-122977514 CCCAGGAAGTTGCTTTTCCCTGG - Intergenic
1017719554 6:157235387-157235409 CCCTGAAACCTCCGACTCCCTGG + Intergenic
1017759738 6:157558848-157558870 CCTAGAAAGTTCCTACAGCAGGG - Intronic
1022059295 7:26775185-26775207 CAGAGAAAGTTCTTTCTCCCTGG + Intronic
1022509211 7:30924425-30924447 AACAGAAAGTTCCAACTACCTGG - Exonic
1022585041 7:31600804-31600826 CCCAGGAAGTTGCTTCTTCCTGG + Intronic
1023367243 7:39475932-39475954 CCCAGAAAGTTCCTACTCCCTGG + Intronic
1024447106 7:49493718-49493740 CCCACAAAGTTCCTGACCCCTGG + Intergenic
1024887577 7:54161864-54161886 CCCGGGAAGTTGCTTCTCCCTGG + Intergenic
1025019741 7:55471776-55471798 CCCAGCAAGCTCCTCCTCCTTGG + Exonic
1025038944 7:55622551-55622573 CCTAGGAAGTTGCTTCTCCCTGG + Intergenic
1025849587 7:65235200-65235222 CCCAGGAAGTTGCTTTTCCCTGG - Intergenic
1026976897 7:74504406-74504428 CACAGAAAGTTCCGTCTCCTGGG - Intronic
1027697528 7:81430701-81430723 TCCAGAAAGTTCCCAGTCTCAGG + Intergenic
1028360810 7:89964351-89964373 CCCAGGAAGTTCCTTCTCCCTGG - Intergenic
1028392529 7:90333777-90333799 CTCAGTAAGTTCCTTCTCTCTGG - Intergenic
1029596649 7:101541224-101541246 AGCAGTAAGTTCCTGCTCCCTGG - Intronic
1030134654 7:106235153-106235175 CCCAGGAAGTTGCGTCTCCCTGG + Intergenic
1030257687 7:107529430-107529452 CCCTGGAAGTTGCTTCTCCCTGG - Intronic
1030260276 7:107556844-107556866 CCCTGCAAGCTCCAACTCCCAGG + Intronic
1030606310 7:111642459-111642481 CCCAGGAAGTTTCTTCTCCCTGG - Intergenic
1031090855 7:117351783-117351805 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1031631458 7:124048358-124048380 CCCACAAAGTTGCTTCTCCCTGG - Intergenic
1032302486 7:130700487-130700509 CCCAGACACTTCCTATTCTCTGG - Intergenic
1033939771 7:146638558-146638580 CACTGCAAGTTCCTCCTCCCGGG + Intronic
1034153785 7:148937717-148937739 CACTGCAAGTTCCGACTCCCGGG - Intergenic
1035680355 8:1483202-1483224 CCCACAAAGTACGGACTCCCTGG - Intergenic
1035945279 8:3954935-3954957 CACAGAAAGTTGTTTCTCCCTGG + Intronic
1036425679 8:8643296-8643318 CCCAGAGAGTTCCTTCTTCAGGG + Intergenic
1038694826 8:29797236-29797258 CTGAGAAAGTTCCAACTCCAGGG + Intergenic
1042863081 8:73333219-73333241 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1043884922 8:85588068-85588090 CCCAGGAAGTTTCTTCTCCCTGG - Intergenic
1044052013 8:87516638-87516660 CACAGAAAGTTGCTTCTCCCTGG + Intronic
1046028210 8:108750607-108750629 CCCAGGAAGTTTCTTCTCCCTGG - Intronic
1046123591 8:109876573-109876595 CTCAAAAGGTTCCTGCTCCCTGG - Intergenic
1046133691 8:109998702-109998724 CCCAGGAAGTTTTTTCTCCCTGG + Intergenic
1046219299 8:111192655-111192677 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1046447522 8:114342137-114342159 TCCAGGAAGTTTCTTCTCCCTGG - Intergenic
1048494985 8:134927549-134927571 CACTGCAAGTTCCTCCTCCCAGG - Intergenic
1049792341 8:144477919-144477941 CCCCGACATTTCCTCCTCCCAGG + Intergenic
1050433295 9:5583909-5583931 CACTGGAAGTTCCTCCTCCCAGG - Intergenic
1052669564 9:31538734-31538756 CCCAGGTAGTTTCTTCTCCCTGG - Intergenic
1052796041 9:32924424-32924446 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1055253649 9:74339020-74339042 CACAGGAAGTTGCTTCTCCCTGG + Intergenic
1055503051 9:76920764-76920786 CACTGAAAGCTCCTCCTCCCAGG - Intergenic
1057133329 9:92669783-92669805 CCCAGTACCTTCCTCCTCCCCGG - Intronic
1057357911 9:94346899-94346921 CACTGCAAGTTCCTCCTCCCGGG - Intergenic
1057649837 9:96910710-96910732 CACTGCAAGTTCCTCCTCCCGGG + Intronic
1057725841 9:97567632-97567654 ACCAGAACCTTCCTGCTCCCAGG - Intronic
1058991817 9:110261072-110261094 CCCAGGCAGTTTCTTCTCCCGGG - Intergenic
1059446877 9:114343562-114343584 CCCAGAAAAATCCTCTTCCCTGG + Intronic
1059598039 9:115744343-115744365 CCCAGGAAGTTTCTTCTCCCTGG + Intergenic
1060584020 9:124774762-124774784 CAATGAAAGTTCTTACTCCCTGG + Intergenic
1061432850 9:130542344-130542366 CCCAGAAAGGGCCTGGTCCCAGG + Intergenic
1062045402 9:134422439-134422461 CCTAGACACTCCCTACTCCCGGG + Intronic
1203636130 Un_KI270750v1:114175-114197 CACTGAAACTTCCTCCTCCCAGG + Intergenic
1185579015 X:1196261-1196283 CACAGCAAGCTCCGACTCCCAGG + Intronic
1185979164 X:4757222-4757244 CCCAGGAAGCTCCACCTCCCGGG + Intergenic
1188156872 X:26751090-26751112 CCCAGGAAGTTGCTTCTACCTGG - Intergenic
1188293033 X:28412177-28412199 CCCAGAAATTTTCTGCTCCTTGG - Intergenic
1188752270 X:33919482-33919504 CCCAGGAAGTTGTTTCTCCCTGG + Intergenic
1189200403 X:39190673-39190695 CCCAGAATATTCCTACTTCATGG + Intergenic
1191189299 X:57649541-57649563 CCCAGGAAGTTGCTTCTCCTGGG + Intergenic
1192244151 X:69359224-69359246 CCCAGAATTTCCTTACTCCCAGG + Intergenic
1192444973 X:71204308-71204330 CACTGAAAGTTCCGCCTCCCAGG + Intergenic
1193583723 X:83294929-83294951 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1194398799 X:93418695-93418717 CCCAGAAAGTTTCTTCTCCCTGG + Intergenic
1194399123 X:93421318-93421340 CTCAGGAAGTTTCTTCTCCCTGG + Intergenic
1194802598 X:98291131-98291153 CCTAGGAAGTTGCTTCTCCCTGG + Intergenic
1195251618 X:103053255-103053277 TCCAGAAAGTGCCAACACCCAGG - Intergenic
1196278744 X:113798336-113798358 CACTGAAAGTTCCACCTCCCGGG + Intergenic
1196419917 X:115510783-115510805 CCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1196526071 X:116728160-116728182 CCCAGGAAGTTGTTTCTCCCTGG - Intergenic
1196894280 X:120319539-120319561 CCCAGAAAGCTGCTCCTTCCAGG - Intergenic
1197075126 X:122344078-122344100 CCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1197260086 X:124308103-124308125 CCCAGACAGGTCCAATTCCCAGG - Intronic
1197470429 X:126861580-126861602 CTCAGGAAGTTGCTTCTCCCTGG - Intergenic
1199217471 X:145277055-145277077 CCCAGGACGTTTCTTCTCCCTGG - Intergenic
1199381460 X:147177411-147177433 CTCAGGAAGTTGCTTCTCCCTGG - Intergenic
1200268961 X:154663056-154663078 CCCAGAAAGTTTCTTCTCCCTGG - Intergenic
1200499929 Y:3936021-3936043 CACTGAAAGTTCCGCCTCCCAGG + Intergenic
1201601235 Y:15730635-15730657 CCCAGAAAGTTGCTTCGACCTGG + Intergenic
1201653290 Y:16315238-16315260 CCCAGGAAATTGCTTCTCCCTGG - Intergenic