ID: 1023367760

View in Genome Browser
Species Human (GRCh38)
Location 7:39481125-39481147
Sequence GACTACTAGGAAAAAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023367758_1023367760 -8 Left 1023367758 7:39481110-39481132 CCTGTGGTTCTTGGGGACTACTA 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1023367760 7:39481125-39481147 GACTACTAGGAAAAAACCCATGG 0: 1
1: 0
2: 1
3: 19
4: 258
1023367754_1023367760 1 Left 1023367754 7:39481101-39481123 CCTTTAGTGCCTGTGGTTCTTGG 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1023367760 7:39481125-39481147 GACTACTAGGAAAAAACCCATGG 0: 1
1: 0
2: 1
3: 19
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023367760 Original CRISPR GACTACTAGGAAAAAACCCA TGG Intronic
900542578 1:3211463-3211485 GACTCCTAAGAAAAGACTCAAGG + Intronic
902746779 1:18479969-18479991 GGCTACTAGGAATAAACACTGGG - Intergenic
907284219 1:53369959-53369981 GACTTTTAGAAAGAAACCCAAGG + Intergenic
907795887 1:57716625-57716647 AACTACTAGAAGAAAACACAGGG + Intronic
908580272 1:65508285-65508307 AACTACTAGAAGAAAACCTAGGG - Intronic
909314379 1:74197668-74197690 GCCTACTAAGAAAAAACAGAGGG + Intronic
915013937 1:152715578-152715600 AACTACTAGGAAAAAAACAGGGG + Intergenic
916617843 1:166461212-166461234 AACTACTAGGAGAAAACATAAGG - Intergenic
917826576 1:178828006-178828028 AACTACTAGAAGAAAACACACGG + Intronic
918410532 1:184253818-184253840 GACTACTTGAAAAATACCAAAGG - Intergenic
918760627 1:188400788-188400810 CACTACTAGACAAAAACACAGGG + Intergenic
924399044 1:243658017-243658039 AACTCCTAGGAAAAAACCACAGG + Intronic
1063768011 10:9164664-9164686 AACTACTAGAAGAAAACCTAGGG - Intergenic
1063844374 10:10109497-10109519 GACTACCAGGAACACACCTATGG + Intergenic
1063901732 10:10740220-10740242 AACTACTAGAAGAAAACACAGGG - Intergenic
1065571670 10:27076862-27076884 GCCAACAAGAAAAAAACCCAGGG + Intronic
1066223275 10:33356998-33357020 GGCTCCTAGGAAAATGCCCAGGG - Intergenic
1071243093 10:83730985-83731007 AACTACTAGAAGAAAACACAGGG - Intergenic
1071332614 10:84574889-84574911 GATAAATAGGAAAAAGCCCATGG - Intergenic
1071678313 10:87678337-87678359 AACTACTAGAAGAAAACACAGGG + Intronic
1072274650 10:93811194-93811216 AACTCCTAGGAGAAAACACAGGG + Intergenic
1072867910 10:99084002-99084024 GACTCTTGGGAAAAAACCCTGGG - Intronic
1073655200 10:105406969-105406991 GAATCCTAGGAGAAAACCTAGGG + Intergenic
1073745108 10:106459596-106459618 CATTACTAGGTATAAACCCAAGG + Intergenic
1074288151 10:112118008-112118030 AACTACTAGAAGAAAACCTAGGG - Intergenic
1074642931 10:115408667-115408689 AACTACTAGAAAAAAACGCCAGG - Intronic
1075816532 10:125269011-125269033 AACTACTAGAAGAAAACACAGGG - Intergenic
1077877647 11:6321059-6321081 GACTATTAGGAAAACACCAGAGG - Intergenic
1078071667 11:8116324-8116346 AACTACTAGAAGAAAACCTAGGG + Intronic
1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG + Intergenic
1081067360 11:38562020-38562042 GACTTCTATAGAAAAACCCAGGG - Intergenic
1085424573 11:76392533-76392555 GAGTAATAGAAAAAAACTCACGG - Intronic
1085612654 11:77966397-77966419 AACTACTAGAAGAAAACACAGGG - Intronic
1086226458 11:84516931-84516953 AACTACTAGAAGAAAACCTAGGG + Intronic
1086397069 11:86426676-86426698 AACTACTAGAAGAAAACACAGGG - Intergenic
1087126469 11:94631636-94631658 GAGCAATAGGGAAAAACCCAAGG + Intergenic
1087352299 11:97047413-97047435 GACTACTACAAACAAACCCTGGG - Intergenic
1089444294 11:118539509-118539531 AAATACTAGAAAAAAACCTAGGG - Intronic
1090518247 11:127451523-127451545 GAACACAAAGAAAAAACCCAAGG + Intergenic
1090628429 11:128625687-128625709 GATTGCTAGGTAAAAACCAAGGG - Intergenic
1091203127 11:133797856-133797878 GACTCCCAGGACACAACCCAGGG + Intergenic
1091985728 12:4909357-4909379 AACTACATGGAACAAACCCAGGG + Intergenic
1092242909 12:6846428-6846450 GTGTACTATGAAAAAACCCGAGG - Intronic
1092628204 12:10350722-10350744 AACTACTAGGAGAAAACGTAGGG - Intergenic
1092900941 12:13058857-13058879 GAAAACCAGGAGAAAACCCAAGG - Intronic
1093080004 12:14799308-14799330 GACGACAAACAAAAAACCCAAGG + Intronic
1094165985 12:27444388-27444410 AACTACTAGAAGAAAACACAGGG + Intergenic
1094457526 12:30654245-30654267 AACTACTAGAAAAAAACACAGGG + Intronic
1096930789 12:55207232-55207254 AACTACTAGGAAAACACATAGGG + Intergenic
1097407401 12:59207140-59207162 AACTACTAGAAGAAAACACAGGG + Intergenic
1097818366 12:64100396-64100418 AACTACAAGGAAAAAATCTATGG + Intronic
1098189817 12:67936141-67936163 TACTCCTAGGCATAAACCCAAGG + Intergenic
1099421283 12:82464209-82464231 AACTACTAGGAGAAAACATAGGG - Intronic
1100342631 12:93695350-93695372 AACTACTAGAAGAAAACCTAGGG + Intronic
1104491511 12:129197681-129197703 AACTACTAGAAGAAAACACAGGG + Intronic
1105592558 13:21807816-21807838 AAGTACTAGGAAAAAACATAGGG + Intergenic
1105698961 13:22920418-22920440 AACTACTAGAAGAAAACACAGGG + Intergenic
1107179302 13:37439950-37439972 AACTACTAGAAGAAAACACAAGG - Intergenic
1107743634 13:43481555-43481577 AACTAGTAGAAGAAAACCCAGGG + Intronic
1108373144 13:49791112-49791134 TACTAGTAGGAAAGAACCTAGGG - Intronic
1108657975 13:52554283-52554305 AACTACTAGAAGAAAACACAGGG - Intergenic
1108714934 13:53069572-53069594 CACTTCTAGGAAAATACACAAGG - Intergenic
1109015513 13:57007437-57007459 AACTACTCGGATAAAACACAGGG + Intergenic
1110514755 13:76396850-76396872 GAATTCAAGGAAGAAACCCAAGG + Intergenic
1116360962 14:43997431-43997453 GAATACTAGGAAATAAGGCAAGG + Intergenic
1116733860 14:48663034-48663056 AACTACTAGAAGAAAACCTATGG + Intergenic
1117935351 14:60898855-60898877 AACTACTAGAAAAAAACAAAGGG - Intronic
1121877963 14:97471430-97471452 TACTTCTAGGAATAAAACCAAGG + Intergenic
1122840149 14:104456603-104456625 AACTACTAGAAGAAAACACAGGG + Intergenic
1124703964 15:31945454-31945476 AACTACTAGAAGAAAACCTAGGG + Intergenic
1125059296 15:35399858-35399880 GATTTCTAAGAAAGAACCCATGG - Intronic
1125247276 15:37654779-37654801 CACTATGAGGAAAAAACACAAGG + Intergenic
1126258920 15:46663779-46663801 AACTACTAGAAAAAAATACAGGG + Intergenic
1127730166 15:61793419-61793441 GACTACTAGAAGAAAACCTAGGG - Intergenic
1128008325 15:64266904-64266926 AACTACTAGAATAAAACACAAGG + Intronic
1128663395 15:69520184-69520206 GGCTACTATAAAAAAACCCCAGG + Intergenic
1130569191 15:85025368-85025390 GACTCCCAGGAAAAAACGCCTGG - Intronic
1134283644 16:12840581-12840603 AACTACTAGAAGAAAACACAGGG + Intergenic
1135090642 16:19512655-19512677 AACTACTAGAAGAAAACACAGGG - Intronic
1136959858 16:34834026-34834048 TAGTACCAGGAAAGAACCCATGG - Intergenic
1137674594 16:50298051-50298073 GACTCATAGGAAAAGGCCCAGGG - Intronic
1137740133 16:50761701-50761723 GAGTACTAGAAGAAAACACAGGG - Intronic
1137994731 16:53198062-53198084 GAGTACTATAGAAAAACCCATGG - Intronic
1138882065 16:61028625-61028647 GACTCAGAGGAAAAAAGCCAAGG - Intergenic
1139619935 16:68130741-68130763 AACTACTAGAAGAAAACACAGGG - Intronic
1140527182 16:75632642-75632664 GCCTACTAGGAAAATACACTGGG + Intronic
1143859864 17:9881296-9881318 GACCACAAGGAGAAAACACATGG - Intronic
1145854118 17:28135554-28135576 GACTTCTAGGAAATAACCTCTGG - Intronic
1150039244 17:61841109-61841131 GACTACTAGAAGAAAACATAGGG + Intronic
1155885390 18:31201615-31201637 AACTACTAGGAAAAAATGTAGGG - Intergenic
1156288391 18:35722073-35722095 GACTGCTGGCAAAAAACCCAAGG + Intergenic
1156629722 18:38952522-38952544 CTTGACTAGGAAAAAACCCAGGG + Intergenic
1157099264 18:44714776-44714798 GACATTTAGGGAAAAACCCAGGG + Intronic
1158302469 18:56067028-56067050 GAGGACTAGGAGAAAGCCCAGGG - Intergenic
1159647256 18:70933600-70933622 GACAACCAGGAAAGAAACCAGGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1165803439 19:38566523-38566545 GGCCACTAGGAAAAGACCCTCGG + Intronic
925688988 2:6501467-6501489 GACTAATAGTGACAAACCCAGGG - Intergenic
926175946 2:10592343-10592365 GAGCATTAGGAAAAAACGCAGGG + Intronic
926565680 2:14469699-14469721 AACTACTAGGAGAAAACATAAGG - Intergenic
927277113 2:21271750-21271772 GGCTACTGGGAAAAAGCCCAGGG - Intergenic
928399318 2:30966435-30966457 GAGTACTAGGTAAGACCCCACGG + Intronic
929091300 2:38219901-38219923 AACTACTAGAAAAAAACATAGGG + Intergenic
929792315 2:45032617-45032639 TAATACTTGCAAAAAACCCAAGG + Intergenic
929935102 2:46288842-46288864 AATTATTAGGAACAAACCCAAGG + Intergenic
930342999 2:50141351-50141373 AACTACTAGAAAAAAACATAGGG + Intronic
930499953 2:52201981-52202003 AACTACTAGAAAAAAACACAGGG + Intergenic
930552737 2:52855708-52855730 AACTACTAGAAGAAAACACAGGG + Intergenic
930638754 2:53834051-53834073 AACTACTAGAAAAAAACAAAGGG + Intergenic
931581686 2:63782206-63782228 AAATACTAGAATAAAACCCAGGG + Intronic
932704051 2:74009828-74009850 GTCTACTAGAATCAAACCCATGG + Intronic
932717780 2:74114995-74115017 AACTACTAGAAGAAAACACAGGG + Intergenic
935942770 2:108258682-108258704 CAGTACTGGGACAAAACCCAAGG - Intronic
936830433 2:116638608-116638630 AACTACTAGAATAAAACTCAGGG + Intergenic
936940686 2:117881385-117881407 GACTACTAGAAGAAAACATAGGG - Intergenic
938245571 2:129774912-129774934 GACTACTAGAAGAAAACATAGGG - Intergenic
938398740 2:130969963-130969985 AACTAAGAGGAAAAAACCTAAGG - Intronic
938999896 2:136722152-136722174 GACTACTAGGAATAAAGGGAAGG - Intergenic
940513762 2:154652716-154652738 TACAATTAGGAAAAAATCCATGG - Intergenic
940592316 2:155745193-155745215 AACTACTAGAAAAAAACAGAGGG + Intergenic
940681550 2:156791893-156791915 GTGTACTAGGAAACATCCCAAGG + Intergenic
940698432 2:157010244-157010266 AACTACTAGAAGAAAACACAAGG + Intergenic
940749300 2:157606910-157606932 AACTACTAGAAGAAAACACAGGG - Intronic
940968238 2:159864338-159864360 AACTACTAGGAGAAAACACAGGG - Intronic
941098259 2:161266350-161266372 GCCAACTAGGCAAAAACACATGG - Intergenic
943619516 2:190132676-190132698 AACTACTAGGAAAAAACACAGGG + Intronic
944284773 2:197936880-197936902 AACTACTAGCAGAAAACACAGGG - Intronic
1169855425 20:10096709-10096731 AACTACTAGAAAAAAACACAAGG + Intergenic
1173305426 20:41842945-41842967 GAAGACTAGAAGAAAACCCAGGG + Intergenic
1173767420 20:45625563-45625585 AACTACTAGAAGAAAACACAGGG - Intronic
1174553799 20:51379840-51379862 GCCTACGTGGAAAGAACCCAGGG - Intergenic
1175076198 20:56376201-56376223 GATTACCAGGAAAAAAACCAAGG + Intronic
1175192763 20:57222576-57222598 GACTGCGAGGAAAAATGCCAAGG + Intronic
1179324551 21:40328526-40328548 CACTACTAGGAGAAAACATAGGG + Intronic
1180139363 21:45882623-45882645 AACCACTAAGAAAAAACACAGGG - Intronic
1181428571 22:22861256-22861278 AACTACTAGAAGAAAACACAGGG + Intronic
1183887867 22:40900129-40900151 AACTATTAGGAAAAAACATAAGG + Intronic
1184243514 22:43223705-43223727 GACTCCTAGGAAAAGACGGACGG + Intronic
949104851 3:191882-191904 AGCTACTAGGAAAAAACTGAGGG - Intergenic
952356053 3:32585084-32585106 AGCTACTAGAAAAAAACCAAGGG + Intergenic
955014377 3:55055157-55055179 AACTACTAGCAGAAAACACAGGG - Intronic
955250025 3:57271980-57272002 TACCACTAGGCAGAAACCCATGG - Exonic
956166250 3:66400377-66400399 GACTACCAGGGAACAACCAAAGG + Intronic
957027801 3:75204343-75204365 AACTACTAGAAGAAAACACAGGG - Intergenic
958715065 3:97770626-97770648 AAGTACTAGGAGAAAACACAGGG - Intronic
959752093 3:109849975-109849997 CAGTACTAGGCAAAATCCCATGG + Intergenic
960493389 3:118345919-118345941 TACTACTAGAAGAAAACACAGGG - Intergenic
960520608 3:118650445-118650467 GACTAAGTGGAAAAGACCCAGGG - Intergenic
961240624 3:125407660-125407682 GACTCCTAGGATTAAACCCTGGG + Intergenic
962011311 3:131393701-131393723 GACTTCTAAGAAAGAGCCCATGG + Intergenic
962472561 3:135725059-135725081 AACTACTAGAAGAAAACACAAGG - Intergenic
964217800 3:154307164-154307186 AACTACTAGAAGAAAACCTAGGG + Intronic
965196296 3:165600323-165600345 TACTACTCGTAAATAACCCATGG + Intergenic
966106467 3:176341511-176341533 AACTACTAGTAGAAAACACAAGG - Intergenic
966133280 3:176668763-176668785 GACTACTAGAAGAAAACACTGGG - Intergenic
966290931 3:178358763-178358785 AACTACTAGGAGAAAACATAGGG + Intergenic
967010461 3:185428194-185428216 GACTTCAAGGAAAAAATCCAAGG - Intronic
967202861 3:187089261-187089283 AACTACTAGAACAAAACACAGGG - Intergenic
968892597 4:3378304-3378326 AACTCCTAGGAGAAAACACAGGG + Intronic
970205986 4:13655815-13655837 GATTTCTATTAAAAAACCCAGGG - Intergenic
971937089 4:33165043-33165065 GAAAACTGGGAAAGAACCCAGGG + Intergenic
972603712 4:40594825-40594847 TACTACTAGGTAAAAAATCAAGG - Intronic
972876923 4:43374072-43374094 GCCTACCCGGAAAATACCCATGG + Intergenic
974344323 4:60659156-60659178 GAAAACTAGGAAATAAACCAGGG - Intergenic
974874861 4:67691133-67691155 GACAACTTGAAAAAAACTCACGG + Intronic
975984738 4:80192091-80192113 CAGTACTTGGAATAAACCCATGG - Intronic
976073214 4:81265936-81265958 AACTACTAGAAGAAAACACATGG - Intergenic
976574125 4:86649326-86649348 AACTACTAGGAAAAAACATTGGG - Intronic
976819006 4:89183781-89183803 AACTACTAGCTAAAAACCTAGGG - Intergenic
978028203 4:103904569-103904591 TGCTACTAGAAAAAAACACACGG - Intergenic
978446491 4:108785656-108785678 GACTACTAGAAGCAAACCCTGGG + Intergenic
978946406 4:114503579-114503601 AACTACTAGAAGAAAACACAAGG - Intergenic
980687272 4:136244252-136244274 AACTACTAGGAGAAAACGTAAGG + Intergenic
982617988 4:157666083-157666105 GACTACTAGCAGCCAACCCAAGG - Intergenic
984687523 4:182687981-182688003 GACTACTAGGAAATGATCAATGG - Intronic
984940917 4:184931790-184931812 AAATACTAGGAGAAAACCTAGGG - Intergenic
985423159 4:189804181-189804203 GACAACTAGGAACAGCCCCAGGG - Intergenic
985428242 4:189851743-189851765 AACTACTAGAAAAAAACATAGGG - Intergenic
985847450 5:2361268-2361290 GACTACTAGAAAAAAAACATAGG - Intergenic
986637621 5:9838313-9838335 GGCTTCTGGGAAAAAAACCAGGG - Intergenic
987501328 5:18713284-18713306 AACTACTAGGAGAAAACATACGG - Intergenic
987986123 5:25148523-25148545 AACTACTAGAAGAAAACACAGGG + Intergenic
988153305 5:27415668-27415690 GGTTACTAGAAATAAACCCATGG + Intergenic
990330093 5:54717072-54717094 GACTACTAGAATAAAACATAGGG + Intergenic
990415936 5:55586798-55586820 GACTACTATGAAAAGATCTATGG + Intergenic
991310384 5:65234174-65234196 GACTACTAGAAGAAAACATAAGG + Intronic
991319005 5:65347543-65347565 GACTACTAGAAAAAAAACATAGG + Intronic
993990743 5:94655035-94655057 AACTACTAGAAGAAAACACAGGG - Intronic
994010798 5:94899816-94899838 GAATACTAGGAAGAAATGCAAGG - Intronic
997776544 5:136613038-136613060 AACTACTAGAAAAAAACATAGGG + Intergenic
998550368 5:143071519-143071541 AACTACTAGAAGAAAACACAGGG + Intronic
999816440 5:155181588-155181610 GACTATGAGGAACAAACACAAGG - Intergenic
999863537 5:155676273-155676295 AACTACTAGAAGAAAACCTAGGG - Intergenic
1001230830 5:169986631-169986653 GAATATTAGAAATAAACCCAAGG - Intronic
1001739328 5:174037677-174037699 TACTCCTAGGATAAAGCCCATGG + Intergenic
1001838422 5:174852470-174852492 GACCACTTGGAAAGAACCCAGGG - Intergenic
1003982053 6:11399082-11399104 AACTACTAGGAGAAAACACTGGG + Intergenic
1006860388 6:37168569-37168591 TATGACTAGGAGAAAACCCAAGG - Intergenic
1009023475 6:57970314-57970336 GACTACTAGCAAGAAACTCAGGG + Intergenic
1009199048 6:60721879-60721901 GACTACTAGCAAGAAACTCAGGG + Intergenic
1009691157 6:67033710-67033732 GACAACTGAGATAAAACCCAAGG + Intergenic
1009789109 6:68377709-68377731 AACTACTAGAAGAAAACCTAAGG - Intergenic
1010831372 6:80534645-80534667 GACTTCCAGGAAAAAATCCATGG + Intergenic
1011029273 6:82903904-82903926 GGCTAAAAGTAAAAAACCCAAGG - Intronic
1012117020 6:95313721-95313743 GAATACTAGAAGAAAACCAAGGG + Intergenic
1013717362 6:112977345-112977367 GACTACTAGAAGAAAACATAGGG - Intergenic
1013921557 6:115411307-115411329 TACTAGTAGGAAAAAACTCTGGG + Intergenic
1014415644 6:121180624-121180646 AACTACTAGGAGAAAACGCTGGG + Intronic
1017105228 6:150881186-150881208 AACTACTAGAAGAAAACACAGGG - Intronic
1017368049 6:153668331-153668353 GGCTACTAGGAAAAATTTCATGG - Intergenic
1018434435 6:163748242-163748264 GACCACTTTGAAGAAACCCAGGG - Intergenic
1019147316 6:169983700-169983722 GACCACAAGGAAAAACCACAAGG + Intergenic
1020726634 7:11823051-11823073 GAATACTAGAAGAAAACCTATGG - Intronic
1020761657 7:12274613-12274635 AACTACTAGAAGAAAACACAGGG - Intergenic
1020771197 7:12397462-12397484 AAATCCTAGGAAAAAACCCTAGG + Intronic
1020949320 7:14654921-14654943 AACTACTAGAAAAAAACAGAGGG + Intronic
1021065520 7:16167665-16167687 GACACCTTGGAAAAAAACCAAGG + Intronic
1023367760 7:39481125-39481147 GACTACTAGGAAAAAACCCATGG + Intronic
1023413202 7:39908473-39908495 GACTACTAGAAGAAAACATAGGG + Intergenic
1023588088 7:41751781-41751803 GATTACTAGGAAAAAATAAATGG - Intergenic
1024090378 7:45934838-45934860 GACTGATGGGAAAAAACTCAGGG + Intergenic
1024776662 7:52795569-52795591 TACTACTAGGTAACTACCCAAGG + Intergenic
1026608084 7:71833028-71833050 AAAGACTAGGCAAAAACCCATGG - Intronic
1028075660 7:86511671-86511693 AACTACTAGGAGAAAACACAGGG - Intergenic
1028287027 7:89014948-89014970 GACTACTAGGGGAAAACATAGGG - Intronic
1028415527 7:90576349-90576371 GACTACTAGAAGAAAACATAGGG + Intronic
1030654220 7:112148529-112148551 GACTACTAGCATAAAATCTAGGG + Intronic
1030813044 7:113999684-113999706 GAGTTCTAGGATAAAAGCCATGG - Intronic
1033061408 7:138112366-138112388 GAGTACTTGGAAAGAATCCATGG + Intronic
1035124590 7:156598793-156598815 AAATACTAGAAGAAAACCCAGGG + Intergenic
1035959610 8:4122710-4122732 TACTTCTAGGAAAAAATCCTGGG - Intronic
1036040973 8:5081279-5081301 GACTATTAGGAAAAAACATGCGG + Intergenic
1038109229 8:24476622-24476644 GACTAATAAGCAAAAATCCACGG + Intronic
1038225080 8:25648438-25648460 AACTACTAGAAGAAAACACAGGG - Intergenic
1039643983 8:39259560-39259582 GTCTTCTTGGAAATAACCCAAGG + Intronic
1039872729 8:41560329-41560351 GACTAATAGGAAGAAAGCAATGG + Intergenic
1040410446 8:47148967-47148989 AACTCCAAGGAAAAAACACAGGG + Intergenic
1041023765 8:53663556-53663578 AACTACTAGAAAACAACACAGGG - Intergenic
1045145923 8:99344345-99344367 AACTACTAGGAGAAAACATAGGG + Intronic
1045171255 8:99671568-99671590 AACTACTAGAAGAAAACACAGGG - Intronic
1045337390 8:101220098-101220120 AACTACTAGAAAAAAACACAGGG + Intergenic
1046817928 8:118606081-118606103 AAATACTAGGAAAAAACGAAAGG + Intronic
1046853045 8:118997406-118997428 AACTTCTATGAAAAAACACAGGG - Intronic
1048174947 8:132143276-132143298 GACTAATAGGACAGAGCCCATGG + Intronic
1048737707 8:137519967-137519989 CACTAGTAGGAAAGAAACCAAGG + Intergenic
1050392745 9:5163414-5163436 GACTACTATAATAAAACTCAAGG + Intronic
1051470241 9:17431640-17431662 AACTACTAGGAAGAAACACTGGG - Intronic
1051933934 9:22421531-22421553 CACTACTAAGAAAAAACCAAAGG - Intergenic
1053206318 9:36189452-36189474 GACTACTATGAGAGAGCCCAAGG - Intergenic
1053563425 9:39220892-39220914 AACTACTAAGAGAAAACACAGGG - Intronic
1053829211 9:42058813-42058835 AACTACTAAGAGAAAACACAGGG - Intronic
1054601348 9:67128634-67128656 AACTACTAAGAGAAAACACAGGG + Intergenic
1054862006 9:69963727-69963749 TACTACAAGGCAAAAAGCCAAGG - Intergenic
1056233193 9:84567606-84567628 CACTCCTAGGAAATGACCCAAGG - Intergenic
1058340819 9:103893965-103893987 TACTACTAGAAGAAAACCCTGGG + Intergenic
1061223662 9:129267411-129267433 GACAAGAAGGATAAAACCCAGGG - Intergenic
1186650008 X:11549040-11549062 AACTACTAGAAGAAAACACAGGG + Intronic
1186723465 X:12330606-12330628 GACCACTAGGGAAAACTCCATGG - Intronic
1188388080 X:29586144-29586166 AACTACTATGAAAACACACAGGG - Intronic
1188724349 X:33563294-33563316 AACTACTAGAATAAAACACAGGG + Intergenic
1189359954 X:40342423-40342445 AACTATTAGGAGAAAACCTAGGG - Intergenic
1189455002 X:41178809-41178831 AACTACTAGAAGAAAACACAAGG - Intronic
1191655169 X:63588223-63588245 GAGTACTAGAATAAAACCTAAGG + Intergenic
1191691363 X:63942042-63942064 AACTACTAGAAAAAAACATAGGG + Intergenic
1191803462 X:65106687-65106709 GATAACAAGGAAAAAACACATGG + Intergenic
1192023191 X:67418257-67418279 AACTACTAGAAAACAACCTAGGG + Intergenic
1192248524 X:69392211-69392233 GAAAAGCAGGAAAAAACCCAGGG + Intergenic
1193057671 X:77171436-77171458 AACTACTAGAAGAAAACCCAGGG + Intergenic
1193324441 X:80163028-80163050 AACTACTAGGAGAAAACACAGGG + Intergenic
1193486442 X:82090058-82090080 GACTCCTTGGCAAAAACACAGGG + Intergenic
1193724576 X:85024311-85024333 GAATACTAGGCACATACCCAAGG - Intronic
1195632513 X:107073035-107073057 AACTACTAGGAAAAAACATAGGG + Intronic
1195725034 X:107906176-107906198 GACCACTGGCAAAAAAACCAGGG + Intronic
1198164739 X:134043931-134043953 AACTGCTAGGAAAAAACATAGGG - Intergenic
1198623128 X:138535820-138535842 AATTACTAGAAGAAAACCCAGGG + Intergenic
1199204084 X:145127030-145127052 GTCTTCTAGGAAAAAATTCAGGG + Intergenic
1199752486 X:150833820-150833842 AGCTACTAGAAAAAAACACAGGG + Intronic
1199781370 X:151063613-151063635 AACTACTAGAAAAAAACATAGGG - Intergenic