ID: 1023368873

View in Genome Browser
Species Human (GRCh38)
Location 7:39492108-39492130
Sequence GTCCTCCGGCATAAGGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023368868_1023368873 1 Left 1023368868 7:39492084-39492106 CCAGGAAAAATCTTACTTGCCAC 0: 1
1: 0
2: 0
3: 6
4: 146
Right 1023368873 7:39492108-39492130 GTCCTCCGGCATAAGGGTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1023368867_1023368873 4 Left 1023368867 7:39492081-39492103 CCACCAGGAAAAATCTTACTTGC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1023368873 7:39492108-39492130 GTCCTCCGGCATAAGGGTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1023368866_1023368873 5 Left 1023368866 7:39492080-39492102 CCCACCAGGAAAAATCTTACTTG 0: 1
1: 0
2: 2
3: 6
4: 165
Right 1023368873 7:39492108-39492130 GTCCTCCGGCATAAGGGTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023368873 Original CRISPR GTCCTCCGGCATAAGGGTTG AGG Intronic
901463303 1:9404526-9404548 GTCCTCAGGCATGGGTGTTGGGG + Intergenic
904483083 1:30806242-30806264 TTCTGCCGGCAGAAGGGTTGGGG + Intergenic
907925093 1:58948494-58948516 GGCCTCCAGCATAAGTGTTTGGG + Intergenic
915586983 1:156849217-156849239 GTCCACCGGCACTGGGGTTGGGG + Intronic
916212003 1:162367118-162367140 GTCCTCTGGCTTAGGGGTCGTGG - Exonic
916522578 1:165578217-165578239 TTCATCAGGCATAGGGGTTGGGG + Intergenic
1073112528 10:101071128-101071150 GTCTCCCAGGATAAGGGTTGAGG + Intergenic
1078863576 11:15276086-15276108 AGCCTCCGGCATAAGGGGTGGGG - Intergenic
1090486362 11:127115985-127116007 GGCCTCCCGCCTTAGGGTTGCGG - Intergenic
1098591937 12:72224370-72224392 GTGCTCCGGAATAATGGTTATGG + Intronic
1106926551 13:34619104-34619126 GTCCTCTGGCAAAATGGTTAGGG + Intergenic
1121812071 14:96900293-96900315 ATCCTCTGGCATGGGGGTTGGGG + Intronic
1123964586 15:25442254-25442276 GTCTGCAGGCATAAGGGTGGGGG - Intergenic
1132483472 16:177877-177899 GTCCTCCCACATATGGGTGGTGG + Intergenic
1137958006 16:52852619-52852641 ATGCTCTGGCATAAGGGTAGGGG + Intergenic
1144249329 17:13399854-13399876 TTCCTCAGGCATAAGGTTAGAGG + Intergenic
1147336344 17:39728790-39728812 GTTCTCCAGCTTCAGGGTTGGGG + Intronic
1148769393 17:50058135-50058157 GTCACCAGGCAAAAGGGTTGCGG - Intronic
1161354967 19:3813836-3813858 GTCCTCCCGCATCAGAGGTGAGG + Exonic
1162015560 19:7844886-7844908 GTCCTCCTGGAATAGGGTTGGGG - Intronic
1162585298 19:11554501-11554523 GTCCTCCTGCATCAGGACTGAGG - Intronic
1163161527 19:15467649-15467671 GTCATCCCACACAAGGGTTGAGG - Intergenic
1164721874 19:30438493-30438515 GTGCTCTGGCAGCAGGGTTGGGG + Intronic
1165831331 19:38731973-38731995 GCCCTCGGGCATAGGGGTGGAGG + Intronic
932526512 2:72475549-72475571 GTGCTCTGGCACAGGGGTTGGGG + Intronic
939919595 2:148092655-148092677 GTACTCAGGAGTAAGGGTTGGGG + Intronic
940265061 2:151828096-151828118 GTCCGCGGGCGTACGGGTTGGGG - Intronic
942171922 2:173297723-173297745 GGCATCCGGCACCAGGGTTGTGG + Intergenic
942501331 2:176593779-176593801 GTCCTCCATCTCAAGGGTTGGGG + Intergenic
1169020896 20:2330087-2330109 GTCCTGTCGCATAAGGGCTGGGG - Intronic
1171376801 20:24699414-24699436 GTCCTGCAGCATAAGGATTCTGG + Intergenic
1174047252 20:47742227-47742249 GTCCTTCTGCATTAGGGCTGGGG - Intronic
1177882302 21:26708755-26708777 GTCCTCCAGCCTTAGGGTGGTGG + Intergenic
952820728 3:37483615-37483637 GTCCTCCTGCCTGAGGGCTGAGG + Intronic
962002141 3:131309100-131309122 GGCCCGCGGCCTAAGGGTTGGGG + Intronic
963043650 3:141087128-141087150 ATCCTCCTGAATAAGGGTCGGGG - Intronic
967847658 3:194057011-194057033 GACCCACGGCATGAGGGTTGAGG - Intergenic
973117266 4:46477267-46477289 GGTCTGCGGCATAGGGGTTGGGG - Intergenic
985762901 5:1760779-1760801 GTCCTCAGGGAGAAGGGCTGTGG + Intergenic
1019597926 7:1866935-1866957 GTCCTCCTGCAGTAGGGATGGGG + Intronic
1022685671 7:32594058-32594080 GTCCTCCGGCCTTGGGGATGGGG + Intergenic
1023368873 7:39492108-39492130 GTCCTCCGGCATAAGGGTTGAGG + Intronic
1028316030 7:89404315-89404337 GTCTTGCAGCCTAAGGGTTGGGG + Intergenic
1033367975 7:140685658-140685680 GTCTGCCGCCATAAGGGATGGGG + Intronic
1037698426 8:21249009-21249031 ATCCTCTGACATAAGGGCTGGGG - Intergenic
1043856967 8:85275101-85275123 GGTATGCGGCATAAGGGTTGTGG + Intronic
1058746418 9:107995862-107995884 GTACTATGGCATAAGGGTTTTGG - Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1062295266 9:135821859-135821881 GTGCTCCGGCCTGAGGGGTGGGG + Exonic