ID: 1023368873

View in Genome Browser
Species Human (GRCh38)
Location 7:39492108-39492130
Sequence GTCCTCCGGCATAAGGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023368867_1023368873 4 Left 1023368867 7:39492081-39492103 CCACCAGGAAAAATCTTACTTGC No data
Right 1023368873 7:39492108-39492130 GTCCTCCGGCATAAGGGTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1023368866_1023368873 5 Left 1023368866 7:39492080-39492102 CCCACCAGGAAAAATCTTACTTG No data
Right 1023368873 7:39492108-39492130 GTCCTCCGGCATAAGGGTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1023368868_1023368873 1 Left 1023368868 7:39492084-39492106 CCAGGAAAAATCTTACTTGCCAC No data
Right 1023368873 7:39492108-39492130 GTCCTCCGGCATAAGGGTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023368873 Original CRISPR GTCCTCCGGCATAAGGGTTG AGG Intronic