ID: 1023370593

View in Genome Browser
Species Human (GRCh38)
Location 7:39508847-39508869
Sequence CTGGAGGGCGAGAGTTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023370593_1023370599 -2 Left 1023370593 7:39508847-39508869 CCCTCAGAACTCTCGCCCTCCAG No data
Right 1023370599 7:39508868-39508890 AGCCACAATTATCTCTGAGAGGG No data
1023370593_1023370598 -3 Left 1023370593 7:39508847-39508869 CCCTCAGAACTCTCGCCCTCCAG No data
Right 1023370598 7:39508867-39508889 CAGCCACAATTATCTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023370593 Original CRISPR CTGGAGGGCGAGAGTTCTGA GGG (reversed) Intergenic
No off target data available for this crispr