ID: 1023374559

View in Genome Browser
Species Human (GRCh38)
Location 7:39543051-39543073
Sequence ATACAGACCTAGAATTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023374549_1023374559 23 Left 1023374549 7:39543005-39543027 CCCAATTCTACCATCCAAATGCT No data
Right 1023374559 7:39543051-39543073 ATACAGACCTAGAATTACATAGG No data
1023374554_1023374559 9 Left 1023374554 7:39543019-39543041 CCAAATGCTGGGTAATATGTCCC No data
Right 1023374559 7:39543051-39543073 ATACAGACCTAGAATTACATAGG No data
1023374553_1023374559 13 Left 1023374553 7:39543015-39543037 CCATCCAAATGCTGGGTAATATG No data
Right 1023374559 7:39543051-39543073 ATACAGACCTAGAATTACATAGG No data
1023374548_1023374559 24 Left 1023374548 7:39543004-39543026 CCCCAATTCTACCATCCAAATGC No data
Right 1023374559 7:39543051-39543073 ATACAGACCTAGAATTACATAGG No data
1023374550_1023374559 22 Left 1023374550 7:39543006-39543028 CCAATTCTACCATCCAAATGCTG No data
Right 1023374559 7:39543051-39543073 ATACAGACCTAGAATTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023374559 Original CRISPR ATACAGACCTAGAATTACAT AGG Intergenic
No off target data available for this crispr