ID: 1023377715

View in Genome Browser
Species Human (GRCh38)
Location 7:39575171-39575193
Sequence AGACATTAGACTGAGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023377705_1023377715 18 Left 1023377705 7:39575130-39575152 CCCCAGAGCTGGCACAGCCAGAG 0: 1
1: 2
2: 6
3: 47
4: 368
Right 1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG 0: 1
1: 0
2: 1
3: 7
4: 187
1023377706_1023377715 17 Left 1023377706 7:39575131-39575153 CCCAGAGCTGGCACAGCCAGAGT No data
Right 1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG 0: 1
1: 0
2: 1
3: 7
4: 187
1023377707_1023377715 16 Left 1023377707 7:39575132-39575154 CCAGAGCTGGCACAGCCAGAGTT 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG 0: 1
1: 0
2: 1
3: 7
4: 187
1023377709_1023377715 1 Left 1023377709 7:39575147-39575169 CCAGAGTTTCAAGGCCCAGAACC No data
Right 1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG 0: 1
1: 0
2: 1
3: 7
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023377715 Original CRISPR AGACATTAGACTGAGTGGTG TGG Intronic