ID: 1023377715

View in Genome Browser
Species Human (GRCh38)
Location 7:39575171-39575193
Sequence AGACATTAGACTGAGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023377706_1023377715 17 Left 1023377706 7:39575131-39575153 CCCAGAGCTGGCACAGCCAGAGT 0: 1
1: 0
2: 2
3: 31
4: 222
Right 1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG 0: 1
1: 0
2: 1
3: 7
4: 187
1023377707_1023377715 16 Left 1023377707 7:39575132-39575154 CCAGAGCTGGCACAGCCAGAGTT 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG 0: 1
1: 0
2: 1
3: 7
4: 187
1023377705_1023377715 18 Left 1023377705 7:39575130-39575152 CCCCAGAGCTGGCACAGCCAGAG 0: 1
1: 2
2: 6
3: 47
4: 368
Right 1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG 0: 1
1: 0
2: 1
3: 7
4: 187
1023377709_1023377715 1 Left 1023377709 7:39575147-39575169 CCAGAGTTTCAAGGCCCAGAACC 0: 1
1: 1
2: 0
3: 12
4: 128
Right 1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG 0: 1
1: 0
2: 1
3: 7
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023377715 Original CRISPR AGACATTAGACTGAGTGGTG TGG Intronic
902594335 1:17498047-17498069 AGTCATTAGGCTGGGTGCTGTGG - Intergenic
903766042 1:25734967-25734989 AGACATTGGATTGAGACGTGTGG + Intronic
904798825 1:33078642-33078664 AAAAATTAGACTGAGAGGAGAGG - Intronic
905303006 1:36998332-36998354 AGACATGAGACAGGGTGTTGGGG - Intronic
909800251 1:79797411-79797433 AAACATAAGACTTAGTGGCGAGG - Intergenic
909937664 1:81572122-81572144 AGACAATAGAGTAATTGGTGAGG + Intronic
911341680 1:96646574-96646596 AGAAATTAGGCTGAGTGCAGTGG + Intergenic
911400711 1:97371424-97371446 AGAATTTATACTCAGTGGTGGGG - Intronic
912691722 1:111809774-111809796 AGACACTGGGCTGAGTGCTGGGG + Intronic
915394702 1:155574067-155574089 AGACATTAGGCTGGGTGCAGTGG + Intergenic
916156405 1:161854104-161854126 AGTGACTAGACTGAGTGGTCAGG + Intronic
917012439 1:170489286-170489308 AGACATAAGACTGAGCGCGGTGG + Intergenic
919148361 1:193663352-193663374 ATACAGTGGACAGAGTGGTGGGG - Intergenic
919440795 1:197630818-197630840 AGACATTATTATTAGTGGTGAGG + Intronic
924203533 1:241686401-241686423 TGACATTAAACAGAGTGGGGAGG - Intronic
1063614581 10:7590876-7590898 AGACATTAGACTTTATGCTGAGG - Intronic
1064417835 10:15166196-15166218 ATACATTATACTGAGTGGTGGGG + Intronic
1065170252 10:23019913-23019935 AGGCATTACACTGAGTGGAAAGG - Intronic
1068120931 10:52781260-52781282 AGACATTGGACTGTGAGATGAGG + Intergenic
1070019225 10:72567490-72567512 AGAGATCAGACTGTGTGGAGAGG + Intronic
1071348808 10:84718827-84718849 AACCATTAGACTTAGTGCTGAGG + Intergenic
1073144360 10:101270722-101270744 GGACTTTAGACTTAGTTGTGAGG + Intergenic
1073831829 10:107393399-107393421 CCACATTAGACCAAGTGGTGGGG - Intergenic
1073888134 10:108065347-108065369 AGACATTGAATTGAGTGGTCTGG - Intergenic
1074774398 10:116756401-116756423 ACACATTACACTGTGTGCTGGGG + Intergenic
1075819495 10:125294232-125294254 AGACTTAAAACTAAGTGGTGGGG + Intergenic
1076946235 10:133652669-133652691 AGATATTTGACTGAGTGTGGTGG - Intergenic
1078953960 11:16168508-16168530 AGACATTAGTTTAAGTGGTTTGG + Intronic
1081382037 11:42428675-42428697 CTACATTAGACAGAGTGGTGAGG + Intergenic
1081428023 11:42946381-42946403 AAACATTAGAATCTGTGGTGAGG + Intergenic
1084511449 11:69607091-69607113 AGACACTAGACTGGGTGTGGTGG - Intergenic
1084838043 11:71819548-71819570 AGAGATTAGAGTGAGTTATGGGG + Intergenic
1085462859 11:76705537-76705559 AGACATTTGGCTGAGAGATGTGG - Intergenic
1090070442 11:123539722-123539744 AGAGAATGGACTGAGTGATGAGG - Intronic
1090933360 11:131319756-131319778 ACACATTAGACTGAAGGGTATGG + Intergenic
1091442318 12:521149-521171 CGCCATTAGACTCAGGGGTGGGG - Intronic
1092293410 12:7179198-7179220 ATACCTTAGACTGAGGGCTGGGG - Intergenic
1096287222 12:50310832-50310854 AAAAATTAGGCTGAGTGTTGTGG + Intergenic
1096568197 12:52498689-52498711 AAAAATTAGACTGTGTAGTGAGG - Intergenic
1096605021 12:52758585-52758607 TGACCTTACATTGAGTGGTGTGG + Intergenic
1097221439 12:57453501-57453523 ATAAATTAGCCTGTGTGGTGTGG + Intronic
1097781240 12:63707488-63707510 AAACAGAAGACTGAGTGGTCTGG + Intergenic
1098020800 12:66154400-66154422 ATCCACTAGGCTGAGTGGTGGGG - Intronic
1100765584 12:97862139-97862161 AGACACTAGATTAAGTGCTGAGG - Intergenic
1106423267 13:29601752-29601774 TGACACTAGACTGATTTGTGGGG + Intergenic
1106481597 13:30141080-30141102 GGACCTGAGGCTGAGTGGTGAGG - Intergenic
1111743287 13:92232259-92232281 TGAAATTAGTCTGCGTGGTGGGG + Intronic
1112156580 13:96823902-96823924 AGAAAATAGACTGGGTGCTGTGG - Intronic
1112369881 13:98785130-98785152 AGACATGAGGCTGAATTGTGAGG - Intergenic
1112813477 13:103246477-103246499 ATACATTAGACTTTGTGCTGAGG + Intergenic
1113245018 13:108385892-108385914 AGTCATGAGACACAGTGGTGAGG + Intergenic
1113705680 13:112431593-112431615 AGAAATGAGACTGAGGGGTCAGG + Intronic
1115914889 14:38301456-38301478 AGACATTGGACTGATGGGAGAGG + Intergenic
1118205709 14:63721168-63721190 AGAAATTAGGCTGGGTGCTGTGG - Intronic
1119635566 14:76270510-76270532 AGACAATAGGCTCAGTGTTGGGG + Intergenic
1119844704 14:77820234-77820256 AGACACTAGAGTGAGTGCTGTGG + Intronic
1120932082 14:89858873-89858895 ATACATAAGAGTGGGTGGTGTGG + Intronic
1202920339 14_KI270723v1_random:25294-25316 AGATATTTGACTGAGTGTGGTGG - Intergenic
1202924592 14_KI270724v1_random:12351-12373 AGATATTTGACTGAGTGTGGTGG + Intergenic
1124638187 15:31378297-31378319 AGACTCTAGGCTGAGGGGTGAGG - Intronic
1127533425 15:59867161-59867183 ATACATTGGAATGTGTGGTGAGG + Intergenic
1131645644 15:94339188-94339210 AGACATTAGCCTGGGGAGTGGGG + Intronic
1132190357 15:99850193-99850215 ATACACTAGACTGAGTAGAGAGG + Intergenic
1132252899 15:100347847-100347869 ATACATTAGGCTGTGAGGTGGGG + Intergenic
1133569921 16:7031095-7031117 AGACTGTAGACTGGGTGGAGAGG + Intronic
1135467600 16:22700873-22700895 AAACATTGGACTGGGTGGTCAGG + Intergenic
1138266071 16:55660547-55660569 AGAGATGAGAGTGAGTGGTCAGG + Intronic
1139566931 16:67783754-67783776 AGACATCAGGCTGAGTGCGGTGG + Intronic
1141662388 16:85448512-85448534 GGACATGAGACTGAGAGATGAGG + Intergenic
1146085934 17:29829680-29829702 AGACATTGTACTGATTGCTGGGG + Intronic
1147271535 17:39275957-39275979 AGTTATTAGACTGGGTGGAGTGG + Intronic
1147572052 17:41577351-41577373 AGGCATTGGGCTGAGTGCTGGGG + Intergenic
1151600889 17:75105335-75105357 AGACATTTGACTGACGGGAGAGG + Intronic
1153005803 18:498282-498304 TTACATTTGTCTGAGTGGTGGGG - Intronic
1154969860 18:21396572-21396594 TGACATTGGAATGAGTGGTATGG - Intronic
1156334783 18:36160075-36160097 AGACATCAGATTGTGGGGTGGGG - Intronic
1158130904 18:54151511-54151533 GGACATCAGACTGGGGGGTGGGG - Intergenic
1161775922 19:6262097-6262119 AGACATTCCAGTGAGTGCTGCGG - Intronic
1162508284 19:11101209-11101231 GGACATTAGGCTGAGTGCGGTGG - Intronic
1165953611 19:39488537-39488559 AGCCATTGCACTGAATGGTGTGG + Exonic
1166158464 19:40933687-40933709 CTACATTAGATTGAGTGGTTAGG + Intergenic
929239090 2:39635408-39635430 AGACATTGTACTAAGTGCTGGGG + Intergenic
929566106 2:42986071-42986093 AGAAATCAGACCAAGTGGTGTGG - Intergenic
931350813 2:61486698-61486720 AAACATTAGTCTGAGTTGGGTGG - Intronic
941389676 2:164896105-164896127 AGAAAATAGATTGAGGGGTGGGG + Intergenic
941671132 2:168294081-168294103 AGACATTAGAGGGAATGGTTTGG - Intergenic
941697872 2:168572842-168572864 AGACATTGTGCTGAGTGGTGGGG - Intronic
941802251 2:169672766-169672788 AGACATTTGAGTCAGTGGTCTGG - Intronic
942110856 2:172681564-172681586 AGACATTATTCTAAGTGCTGGGG + Intergenic
942382178 2:175403534-175403556 GGACATTATACTGTGTGCTGTGG + Intergenic
942555532 2:177168938-177168960 ACACAAAAGTCTGAGTGGTGGGG + Intergenic
943187428 2:184629865-184629887 TGGCATTAGGCTGAGTGCTGGGG + Intronic
943725039 2:191244884-191244906 AAAAATTATACTGAGTGGTGTGG - Intergenic
947967509 2:234294006-234294028 AGAGAATAAACTGAGGGGTGGGG - Intergenic
948960403 2:241330880-241330902 AGAAATTAGGCTGAGTGCAGTGG + Intronic
1169628254 20:7597058-7597080 AGACAGTAGACTAGGGGGTGGGG + Intergenic
1172079959 20:32332359-32332381 AGACATGAGACTCAGTGCAGTGG + Exonic
1174714581 20:52744089-52744111 AGACTTTAGACTGATCGGTCAGG - Intergenic
1176645369 21:9344604-9344626 AGACACTGGACAGAGCGGTGTGG + Intergenic
1176728569 21:10465958-10465980 AGGCATCTGCCTGAGTGGTGGGG + Intergenic
1179233910 21:39528574-39528596 AGACATAAGTCTGAGAGCTGAGG + Intergenic
1179565984 21:42249383-42249405 AGAACTTAAACTGAGTGGTCTGG - Intronic
1180378499 22:12116703-12116725 AGACACTGGACAGGGTGGTGTGG + Intergenic
1183103676 22:35599538-35599560 AGACCTTCAACTGATTGGTGCGG + Intergenic
1184520773 22:44992729-44992751 AGGCATAAGAATGAGTGATGTGG + Intronic
949448580 3:4162129-4162151 GGGCATTAGACAGAGTTGTGAGG - Intronic
953979875 3:47408244-47408266 AGACCTCAGATTGAGTGGTGAGG + Intronic
954174493 3:48833325-48833347 AGAAATTAGCCTGAGTGCAGTGG - Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
955951328 3:64245396-64245418 AAAGATGAGACTGAGAGGTGAGG - Intronic
956377691 3:68633427-68633449 AGACAATACACTAAGTGTTGTGG - Intergenic
956442047 3:69290090-69290112 AGACACTAGACTGATGGGAGAGG - Intronic
956497050 3:69839184-69839206 AGACATTAGAATAAGTGGCTGGG + Intronic
957081248 3:75637793-75637815 AGATATTTGACTGAGTGTGGTGG + Intergenic
957094951 3:75769439-75769461 AGACACTGGACAGGGTGGTGTGG - Intronic
959285847 3:104409802-104409824 AGGCATTATTCTGAGTGGTAGGG + Intergenic
960460666 3:117930970-117930992 AGACATTAGATTGAGTAATAAGG - Intergenic
966824866 3:183955011-183955033 TGAAATTAGCTTGAGTGGTGGGG + Intronic
967207421 3:187136916-187136938 AGACTTTAGGCTGAGTGCAGTGG + Intronic
967510460 3:190305132-190305154 AGACATTAGCATGATGGGTGAGG - Intergenic
967777317 3:193397859-193397881 CAACATTAGACAGAGTGGTCAGG + Intergenic
1202741521 3_GL000221v1_random:60464-60486 AGACACTGGACAGAGCGGTGTGG - Intergenic
969779459 4:9387052-9387074 AGAGATTAGAGTGAGATGTGGGG + Intronic
972234598 4:37116288-37116310 AGTGATTAGACAGAGTGGTCAGG + Intergenic
972768264 4:42171712-42171734 AGACATCAGACTAAGTGTTTAGG - Intergenic
973186572 4:47336883-47336905 AGAGATGGGAGTGAGTGGTGAGG + Intronic
973968379 4:56186603-56186625 AGACATTGTGCTGAGGGGTGAGG + Intronic
974540994 4:63235516-63235538 AGACATTAGACAGAATTGGGAGG + Intergenic
975442442 4:74427048-74427070 CGGCATTAGACTGAGTGAGGTGG + Intergenic
975444022 4:74442103-74442125 AGGCATCAAACTGAGTGGTTAGG + Intergenic
977899693 4:102405669-102405691 AGACATAAAACTGAGTTTTGAGG + Intronic
978497891 4:109379587-109379609 AAAAATTACACTGAGAGGTGGGG - Intergenic
979140902 4:117173072-117173094 AGACATTTGTCTAAGAGGTGAGG + Intergenic
982116868 4:152105338-152105360 AGACATTGGAGTCAGTGGTTTGG - Intergenic
982151421 4:152462167-152462189 AGAGATTATACTGAGATGTGTGG + Intronic
984514301 4:180719486-180719508 GGACAGTAGCCTCAGTGGTGGGG + Intergenic
985449648 4:190053322-190053344 AGATATTTGACTGAGTGTGGTGG - Intergenic
1202760119 4_GL000008v2_random:102169-102191 AGACACTGGACAGGGTGGTGTGG + Intergenic
987452378 5:18102258-18102280 AGACATAAGACTAAATGCTGAGG + Intergenic
988994371 5:36700639-36700661 ACTCAAGAGACTGAGTGGTGAGG + Intergenic
992120290 5:73585659-73585681 TGACATGAGATTCAGTGGTGAGG + Intergenic
996474035 5:123894935-123894957 AGACATTGGGCTGGGTGGGGTGG + Intergenic
998016095 5:138733619-138733641 ATACCTTAGACTGGGTGGTCAGG + Intronic
999344591 5:150804902-150804924 AGCCATTAGAAAGAGGGGTGGGG + Intergenic
1000209757 5:159098304-159098326 AGACACTAGACTGTGTGGCCTGG - Intronic
1000270131 5:159676586-159676608 AGACAGTTGACTGGGTGTTGGGG + Intergenic
1000270215 5:159677092-159677114 AGACAGTTGACTGGGTGTTGGGG - Intergenic
1000627673 5:163557937-163557959 AAACATTAAACTGAGTGTTTGGG - Intergenic
1008886474 6:56436489-56436511 AGACATTACCCTGAGGGTTGTGG + Intergenic
1009245379 6:61231200-61231222 AGACATTAGACTGGGGCGGGAGG + Intergenic
1010822299 6:80429762-80429784 AGATTTTGGGCTGAGTGGTGGGG + Intergenic
1011458423 6:87577482-87577504 AGAAATAAGACTGAGTGCAGTGG - Intronic
1013152581 6:107460082-107460104 AGACATAAGGCAGCGTGGTGCGG + Intergenic
1013798202 6:113908911-113908933 AGACACTAGACGGGGTGGTCAGG + Intergenic
1013810466 6:114039432-114039454 AGACAGTGGACTGAGTTTTGGGG - Intergenic
1014190694 6:118493375-118493397 AGACACTAGATTGAATGCTGGGG - Intronic
1016674399 6:146747435-146747457 AGTCATCAAGCTGAGTGGTGAGG + Intronic
1017097048 6:150813571-150813593 TGACATTAGGCTGAGTGAAGAGG + Intronic
1017995014 6:159524862-159524884 AGAGCTTTGACTGAGTGATGAGG - Intergenic
1019999429 7:4746908-4746930 AGACATAAGAGGGTGTGGTGGGG - Intronic
1020171021 7:5845093-5845115 AGACATAAGCCTCAGAGGTGAGG + Intergenic
1020401109 7:7778701-7778723 AAACATTAGGCTGAGTGTGGTGG - Intronic
1022939827 7:35223559-35223581 AAACAGAAGACTGAGTGGTCTGG + Intronic
1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG + Intronic
1025972739 7:66343116-66343138 ACACAGGAGACTGATTGGTGTGG - Intronic
1028294527 7:89111951-89111973 AGAAATTAGGCAGAGTGGTGGGG + Intronic
1032588167 7:133167241-133167263 AAACATTAGACTGAAGGATGGGG - Intergenic
1033140106 7:138818509-138818531 AGAAATAAAATTGAGTGGTGTGG - Intronic
1033249514 7:139746754-139746776 AGCCACCTGACTGAGTGGTGAGG - Intronic
1033660977 7:143401749-143401771 GGACAGTAGACTGAGTGTTTAGG + Intronic
1034136280 7:148773291-148773313 AGACATTAGCCAGAGTTTTGGGG - Intronic
1034601523 7:152262003-152262025 AGGCATCTGCCTGAGTGGTGGGG - Intronic
1034608907 7:152346654-152346676 AGATTTTTGACTGTGTGGTGGGG - Intronic
1037262459 8:17024057-17024079 AGACGTTAGCCTGCGTGGTCCGG + Intergenic
1038300092 8:26336465-26336487 AGATTTGAGACTGAGGGGTGGGG - Intronic
1039184349 8:34900154-34900176 AGACAGTAAATTGAGTGGGGTGG + Intergenic
1040721681 8:50331630-50331652 GGACAATAGACTGAATGATGTGG + Intronic
1042162142 8:65907252-65907274 AGAAATGAGACTGACTGGTAGGG - Intergenic
1043530869 8:81148450-81148472 AGACAAGAGGCTGGGTGGTGGGG - Intergenic
1043950906 8:86308078-86308100 AGTCATGAGCCTGAGAGGTGAGG + Intronic
1044239520 8:89872405-89872427 TGACATTAGACTGAGTGTGGTGG - Intergenic
1045747719 8:105442595-105442617 AGACATGGGATTCAGTGGTGTGG + Intronic
1049472239 8:142781674-142781696 AGGCATAGGATTGAGTGGTGGGG - Intergenic
1056954207 9:91069499-91069521 AGGCAGCAGACTGAGTGGAGAGG - Intergenic
1057601856 9:96465054-96465076 AGAGAGTAGGCTAAGTGGTGGGG - Intronic
1058257297 9:102783312-102783334 ATACAAGAGACTGATTGGTGCGG - Intergenic
1059989239 9:119848991-119849013 AGACATCAGACTGGGTGCAGTGG - Intergenic
1203710156 Un_KI270742v1:90388-90410 AGACACTGGACAGAGCGGTGTGG - Intergenic
1203540894 Un_KI270743v1:87063-87085 AGACACTGGACAGGGTGGTGTGG + Intergenic
1187261203 X:17686732-17686754 AGAGATGAGACTGGGAGGTGGGG + Intronic
1192326665 X:70138191-70138213 AGAAATTAGGCTGAGTGCGGTGG + Intronic
1192806327 X:74512715-74512737 AGACATTAGCCTGAGTGCCTGGG + Intronic
1193772254 X:85601851-85601873 AGGCACTAGGCTAAGTGGTGGGG + Intergenic
1194229779 X:91307468-91307490 AGACAGTGGACTGGGGGGTGGGG - Intergenic
1194438165 X:93894803-93894825 AGACAGTGGACTGGGGGGTGGGG - Intergenic
1194735082 X:97503172-97503194 AGACATTTTACTAAGTGCTGAGG + Intronic