ID: 1023380859

View in Genome Browser
Species Human (GRCh38)
Location 7:39607224-39607246
Sequence GGACATAGACAACACTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023380859_1023380869 20 Left 1023380859 7:39607224-39607246 CCTCCCCAGTGTTGTCTATGTCC 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1023380869 7:39607267-39607289 TATGTTAGATTATATAGGAAAGG No data
1023380859_1023380868 15 Left 1023380859 7:39607224-39607246 CCTCCCCAGTGTTGTCTATGTCC 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1023380868 7:39607262-39607284 GAAACTATGTTAGATTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023380859 Original CRISPR GGACATAGACAACACTGGGG AGG (reversed) Intronic
900001858 1:18886-18908 GGAGCTAGACCACACTGAGGCGG - Intergenic
900021578 1:189409-189431 GGAGCTAGACCACACTGAGGCGG - Intergenic
901323505 1:8353432-8353454 GGACAGAGACCACACTGGGTCGG - Exonic
909157930 1:72104166-72104188 GGACATAGACATCTTTGGGAGGG - Intronic
910036633 1:82796750-82796772 GGATATAGACTACACTTGAGTGG - Intergenic
911371955 1:97004453-97004475 GGCCATAGACTACACTGGCCTGG + Intergenic
912047874 1:105483367-105483389 GGACATAAACAAGACTAGAGAGG - Intergenic
912435570 1:109658734-109658756 GGCCATACACAGCCCTGGGGAGG + Intronic
913524446 1:119677598-119677620 GGAAAAAGACAACACCGTGGGGG - Intronic
913663077 1:121021699-121021721 GGACAAAGAAAACACTGGCATGG + Intergenic
914014460 1:143804964-143804986 GGACAAAGAAAACACTGGCATGG + Intergenic
914163359 1:145156237-145156259 GGACAAAGAAAACACTGGCATGG - Intergenic
914678492 1:149922229-149922251 GGAAATTGATAACACTGGGGAGG - Intergenic
915228321 1:154427670-154427692 AGACATAGACATCAAAGGGGCGG - Intronic
916532944 1:165675529-165675551 GGAGATGGACAAAACTGGGTGGG + Intronic
919876782 1:201875124-201875146 AGACATAGCCAACACAGGGCGGG - Intronic
919894388 1:201999954-201999976 GCACATGGACATCACTGGAGAGG + Exonic
921732260 1:218591630-218591652 GAACATGGACATCACTGGGGGGG - Intergenic
922714295 1:227858848-227858870 GGACAAAGACCACAGTGGGGAGG - Intergenic
922893215 1:229077576-229077598 GGAAAGAGACAACAGTAGGGAGG + Intergenic
1062902042 10:1153906-1153928 GGACAGAGACACCAGTGGGGTGG - Intergenic
1063599044 10:7463474-7463496 GGACAGACAGAAGACTGGGGTGG + Intergenic
1063615580 10:7597238-7597260 GGCCATGGACACCAGTGGGGAGG + Intronic
1064074482 10:12257921-12257943 GATCATAGAGAACACTGGGAAGG - Intergenic
1064880569 10:20048376-20048398 GAATATAGAAAAAACTGGGGTGG - Intronic
1069086550 10:64146621-64146643 GGACATGGACATCATTGGGTGGG - Intergenic
1069264526 10:66441756-66441778 GGAAATAGATAACATTTGGGTGG + Intronic
1072536973 10:96371420-96371442 GGGCATGGAGCACACTGGGGAGG - Intronic
1072764502 10:98084551-98084573 GGACACAGGCATCACTGGGCTGG + Intergenic
1076570264 10:131428103-131428125 GGCCAAAGCCAACATTGGGGTGG - Intergenic
1076996649 11:300285-300307 AGCCAGAGACAAGACTGGGGCGG - Intergenic
1081667265 11:44923832-44923854 GAACAGAGACACCCCTGGGGAGG - Intronic
1087021895 11:93611358-93611380 GGACATGGACATCTTTGGGGAGG + Intergenic
1088573998 11:111252150-111252172 GGACTTAGACAACTCTGGGAAGG - Intergenic
1091374937 12:18991-19013 GGAGCTAGACCACACTGAGGCGG - Intergenic
1093719157 12:22418448-22418470 GAACATAGATATCTCTGGGGGGG - Intronic
1095858903 12:46892633-46892655 GGACAGAAAGAACACTCGGGGGG - Intergenic
1096186363 12:49584208-49584230 GGACACAGACAACACTCAGAGGG + Intronic
1096273528 12:50186030-50186052 GGACATAGAAAATAAAGGGGAGG - Intronic
1097243413 12:57591568-57591590 GGACCAAGACAACCCGGGGGAGG - Intronic
1102517417 12:113459070-113459092 GGACTTAAATAACCCTGGGGTGG - Intergenic
1104152620 12:126098149-126098171 GGACATGGACCACTCTGGGAGGG - Intergenic
1106075497 13:26457381-26457403 GGACATGGACATCATGGGGGTGG - Intergenic
1106834046 13:33614810-33614832 GGTCAAAGACAAGGCTGGGGAGG + Intergenic
1109117086 13:58401963-58401985 GGACTTAACCAACTCTGGGGGGG + Intergenic
1110795532 13:79632558-79632580 GGACATAAAGGATACTGGGGTGG + Intergenic
1110856994 13:80307832-80307854 GGACATAGACCAGACAGTGGGGG + Intergenic
1113096746 13:106673439-106673461 TGAGATAGACAACACTGTGGAGG + Intergenic
1113547217 13:111162924-111162946 GAACAAAGACAACACTTGGCTGG - Intronic
1119989362 14:79178083-79178105 GTACATAGGCATCACTGGGTGGG + Intronic
1121572356 14:94956586-94956608 GGACAGAGAAAAGCCTGGGGTGG - Intergenic
1121660421 14:95631254-95631276 GAACATGGACATCTCTGGGGAGG - Intergenic
1125431800 15:39602792-39602814 GTACATAGACAACACTATAGAGG - Intronic
1126738826 15:51757650-51757672 GGACAGACACACCACTGGAGGGG + Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127708828 15:61574911-61574933 GGGCAAAGACCTCACTGGGGTGG + Intergenic
1129272777 15:74428210-74428232 GGGAACAGACAGCACTGGGGCGG + Intronic
1130620820 15:85460520-85460542 GGACATGGACAACTTTGTGGGGG - Intronic
1131123811 15:89841082-89841104 GAAGATAGACAACAGTGTGGTGG + Intronic
1131493155 15:92880467-92880489 GGAGATTGACAGCAATGGGGTGG + Intergenic
1132451651 15:101972054-101972076 GGAGCTAGACCACACTGAGGCGG + Intergenic
1132455238 16:18575-18597 GGAGCTAGACCACACTGAGGCGG - Intronic
1134371647 16:13631552-13631574 TGACATAGACAAAAATGGGGTGG - Intergenic
1134872852 16:17667365-17667387 GGACATAGGCATCTCTGGGAGGG + Intergenic
1146465028 17:33079617-33079639 GGACAGAGTGAGCACTGGGGAGG + Intronic
1147162371 17:38575690-38575712 GGACAGAGACAACTGGGGGGAGG - Intronic
1147880534 17:43650784-43650806 CGAAATAGACAAGACTGGGATGG + Intronic
1147955606 17:44132400-44132422 GGATAGAGACAACTCTGGGCTGG + Intergenic
1148766130 17:50039277-50039299 GGACATAAACACAGCTGGGGTGG + Intergenic
1149440107 17:56666831-56666853 GGCTCTAGACAATACTGGGGAGG - Intergenic
1152350127 17:79779432-79779454 GGACGCTGACAGCACTGGGGAGG + Intronic
1153947322 18:10029381-10029403 GGAAAAAGAAGACACTGGGGAGG + Intergenic
1156187389 18:34678649-34678671 GGAGGAAGAGAACACTGGGGAGG + Intronic
1156956033 18:42964533-42964555 TAACATAGACAAAACTGGGCAGG - Intronic
1158446895 18:57529691-57529713 GGAAATAGCCAACCCTGGGAAGG + Intergenic
1159647386 18:70935367-70935389 GGACATAGACATCATTGTGGGGG - Intergenic
1160633610 19:60494-60516 GGAGCTAGACCACACTGAGGCGG - Intergenic
1162578012 19:11510605-11510627 GGAAATAGTCACCTCTGGGGAGG + Intronic
1168250096 19:55137113-55137135 GGACATTGACTACATGGGGGAGG - Exonic
926092010 2:10057524-10057546 GGAAAAAGAAAACGCTGGGGAGG + Exonic
927458669 2:23278794-23278816 GGTCACAGAGAAGACTGGGGAGG + Intergenic
927676705 2:25111526-25111548 GGACATAGGCAACCGTGGGATGG - Intronic
930856525 2:56024957-56024979 GGACACAGACCACAATGGGGTGG - Intergenic
935528144 2:104198182-104198204 GCACATAAACAACACTGTAGTGG - Intergenic
935698593 2:105790796-105790818 GCACATAGGCAAGACTTGGGTGG + Intronic
936080538 2:109429773-109429795 GGCCACAGACAGCCCTGGGGAGG + Intronic
936567863 2:113594521-113594543 GGAGCTAGACCACACTGAGGCGG + Intergenic
937343836 2:121110409-121110431 GGACATAAAGCACTCTGGGGAGG + Intergenic
938578686 2:132627013-132627035 TGACATCCCCAACACTGGGGCGG - Intronic
948198666 2:236113787-236113809 GGACATAGGAATCACTGGGTAGG - Intronic
1172359237 20:34300822-34300844 GGAGAGAGACCAGACTGGGGTGG + Intronic
1173327240 20:42045193-42045215 GGACATAGACACCTTTGGGAGGG + Intergenic
1176367698 21:6043874-6043896 AGAGACAGAGAACACTGGGGAGG + Intergenic
1177884855 21:26734840-26734862 GTACATAGGAATCACTGGGGTGG + Intergenic
1179755821 21:43494668-43494690 AGAGACAGAGAACACTGGGGAGG - Intergenic
1182533584 22:30982332-30982354 GGAAAAAGATAACACTGGGTAGG - Intergenic
1185275073 22:49947255-49947277 GGACAGACACAGCTCTGGGGAGG - Intergenic
950497706 3:13343886-13343908 GCACATAGCTCACACTGGGGTGG - Intronic
952251591 3:31661522-31661544 GGACAGACAAAACACTGAGGTGG + Exonic
953139130 3:40211245-40211267 GGACACAGAAAACACCTGGGAGG - Intronic
956587622 3:70881219-70881241 GGAATGAGACAACACTGGGAGGG + Intergenic
956757149 3:72400207-72400229 GGAGGTAGACTACAATGGGGTGG + Intronic
957117691 3:76047488-76047510 GGAGATTGACAGCACTGTGGAGG + Intronic
958419205 3:93912434-93912456 GGACATAGATATGTCTGGGGCGG + Intronic
960569878 3:119175471-119175493 GGACAGAGACCACATTGGTGAGG + Intronic
962545475 3:136429786-136429808 TGACATTGAGTACACTGGGGAGG - Intronic
962742968 3:138376312-138376334 GGGCATAGAAATGACTGGGGTGG - Intronic
965143807 3:164871595-164871617 GGATGTAGACATCTCTGGGGAGG + Intergenic
966646395 3:182250469-182250491 GGATAGAGAAAACAATGGGGTGG - Intergenic
966964524 3:184977103-184977125 GGACATTCACAACGCTGCGGAGG - Intronic
968312215 3:197693456-197693478 GGAGAAAGACACCACTGAGGAGG + Intronic
969073179 4:4556338-4556360 GGGCATTGACCACACTGTGGGGG + Intergenic
969633388 4:8351375-8351397 GGACACAGAGAACACAGGGCGGG + Intergenic
972533227 4:39978205-39978227 GGACATAGACGAAACTGGTTGGG + Intergenic
973219424 4:47708546-47708568 GGACATGGACATCTTTGGGGGGG + Intronic
973272447 4:48275476-48275498 AGACATGGACATCACTGGGAGGG - Intergenic
973550532 4:52031212-52031234 GAGCACAGAAAACACTGGGGGGG - Intronic
984352125 4:178608625-178608647 GGAGAAAGAAAACAGTGGGGTGG + Intergenic
995476633 5:112554762-112554784 GGCCAGAGACACCACTGTGGTGG + Intergenic
997527627 5:134563584-134563606 GGGCACAGGCAACACTGGAGTGG - Intronic
998750656 5:145318276-145318298 TGACATAGACAACAATGGCTTGG - Intergenic
1002006778 5:176240327-176240349 GAAAATGGACAACACTTGGGAGG - Intronic
1002219598 5:177670309-177670331 GAAAATGGACAACACTTGGGAGG + Intergenic
1003868415 6:10383376-10383398 GGAGTTAGGCAACTCTGGGGAGG - Intergenic
1005347465 6:24904579-24904601 GGACATGGACATCTTTGGGGTGG + Intronic
1005421139 6:25652346-25652368 GGACCTAGACAACTTTGGGAAGG - Exonic
1005678672 6:28182938-28182960 GGACATAGACATCTTTGGGTGGG + Intergenic
1006744035 6:36329205-36329227 GCACATAGGCACCAGTGGGGTGG + Intronic
1010246906 6:73669335-73669357 GGACATAGAAAACATTTGAGAGG + Intergenic
1011607675 6:89119964-89119986 AGACATACCCAAGACTGGGGAGG + Intergenic
1011823872 6:91283706-91283728 GGACATAGACAACTCTGGAGGGG - Intergenic
1013423829 6:109992243-109992265 GGACCTAGCCAACACAGAGGAGG + Intergenic
1013756038 6:113462807-113462829 GGACACAGACCACACTTGAGAGG + Intergenic
1014885773 6:126779520-126779542 GAACAAAGACTACACTTGGGTGG + Intergenic
1016495617 6:144658544-144658566 GGGCATAGACCAAAGTGGGGGGG - Intronic
1019056618 6:169228155-169228177 CGACACAGACAACAATGGAGAGG - Exonic
1021119888 7:16787197-16787219 GGACTTTGACATCACTTGGGGGG + Intergenic
1021844594 7:24752303-24752325 GGCCAGAGACAAAGCTGGGGAGG + Intronic
1023344404 7:39256495-39256517 GGACATAGACATCTTTGGTGAGG - Intronic
1023380859 7:39607224-39607246 GGACATAGACAACACTGGGGAGG - Intronic
1024889945 7:54188561-54188583 GAACATAAACAGCACTGGTGAGG + Intergenic
1025141926 7:56473988-56474010 GGACAGAGAAAAAAATGGGGAGG - Intergenic
1025708069 7:63885427-63885449 GGACAGAGAAAATAATGGGGAGG - Intergenic
1029704901 7:102271006-102271028 TGACCAAGACCACACTGGGGTGG + Intronic
1033039123 7:137902313-137902335 GGGCATTGAGAACACTAGGGAGG - Intronic
1034495432 7:151418288-151418310 GGAATTAAACAACACTGGGTGGG + Intergenic
1043560640 8:81489492-81489514 TGTCACAAACAACACTGGGGAGG - Intergenic
1045651724 8:104347774-104347796 GGACATGGACAACTCTGAGGGGG - Intronic
1046138222 8:110059204-110059226 GGACATGGACATTACTGGCGGGG + Intergenic
1047323388 8:123811643-123811665 TGAAATAGAGAAGACTGGGGAGG + Intronic
1047850438 8:128851600-128851622 GGACATGGACATCCTTGGGGTGG - Intergenic
1048743700 8:137590223-137590245 GGACATAGACATATCTGGAGGGG - Intergenic
1049884666 9:18999-19021 GGAGCTAGACCACACTGAGGCGG - Intergenic
1051182782 9:14428734-14428756 GGATAAAGACAACACTGTTGAGG + Intergenic
1051743542 9:20274227-20274249 GGATATAGCCAAAACAGGGGAGG + Intergenic
1051775861 9:20633323-20633345 GGACATATACAAGAAGGGGGAGG + Intergenic
1052560500 9:30078145-30078167 GGACAGAGAGAAGCCTGGGGAGG + Intergenic
1055882574 9:81019285-81019307 GGAGAGAGATAACACTGGGTCGG + Intergenic
1060140507 9:121205486-121205508 GGAGAGAGACAGCACTGGAGGGG + Intronic
1060522191 9:124300253-124300275 GGAAACAGACTACAGTGGGGAGG + Intronic
1061332559 9:129905149-129905171 GGATATAGACAACTCTGTTGAGG - Intronic
1187135494 X:16543535-16543557 GGACATGGATATCTCTGGGGAGG + Intergenic
1187284201 X:17887154-17887176 GGACAATGACAGCTCTGGGGTGG - Intergenic
1190040085 X:47064322-47064344 GGACATGGACATCTTTGGGGGGG - Intergenic
1191721462 X:64231961-64231983 TGAGGTAGACAAGACTGGGGAGG - Intergenic
1192135672 X:68597435-68597457 GGACATAGAGAACAGAGGGATGG + Intergenic
1192262805 X:69517587-69517609 TGATGTTGACAACACTGGGGTGG + Intronic
1192945955 X:75965889-75965911 AGACATAGACAACAATCTGGAGG + Intergenic
1193933004 X:87580864-87580886 AGAAATAGACATCACTGGGCAGG + Intronic
1196346312 X:114663819-114663841 GGAAATAGACTAGACTGCGGGGG + Intronic
1198539549 X:137622356-137622378 AGACATGGACAAAGCTGGGGAGG + Intergenic
1200401141 X:156021153-156021175 GGAGCTAGACCACACTGAGGCGG + Intergenic