ID: 1023381679

View in Genome Browser
Species Human (GRCh38)
Location 7:39614392-39614414
Sequence AGAGAGGGCTAGATGTCTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023381679_1023381686 11 Left 1023381679 7:39614392-39614414 CCGAAAGACATCTAGCCCTCTCT No data
Right 1023381686 7:39614426-39614448 AGCCATGAGGTATGAGGATTGGG No data
1023381679_1023381685 10 Left 1023381679 7:39614392-39614414 CCGAAAGACATCTAGCCCTCTCT No data
Right 1023381685 7:39614425-39614447 CAGCCATGAGGTATGAGGATTGG No data
1023381679_1023381684 5 Left 1023381679 7:39614392-39614414 CCGAAAGACATCTAGCCCTCTCT No data
Right 1023381684 7:39614420-39614442 CGTGGCAGCCATGAGGTATGAGG No data
1023381679_1023381683 -2 Left 1023381679 7:39614392-39614414 CCGAAAGACATCTAGCCCTCTCT No data
Right 1023381683 7:39614413-39614435 CTAGTGTCGTGGCAGCCATGAGG No data
1023381679_1023381688 23 Left 1023381679 7:39614392-39614414 CCGAAAGACATCTAGCCCTCTCT No data
Right 1023381688 7:39614438-39614460 TGAGGATTGGGAGATATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023381679 Original CRISPR AGAGAGGGCTAGATGTCTTT CGG (reversed) Intergenic