ID: 1023381681

View in Genome Browser
Species Human (GRCh38)
Location 7:39614407-39614429
Sequence GGCTGCCACGACACTAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023381681_1023381689 16 Left 1023381681 7:39614407-39614429 CCCTCTCTAGTGTCGTGGCAGCC No data
Right 1023381689 7:39614446-39614468 GGGAGATATCAGTGGCCATATGG No data
1023381681_1023381688 8 Left 1023381681 7:39614407-39614429 CCCTCTCTAGTGTCGTGGCAGCC No data
Right 1023381688 7:39614438-39614460 TGAGGATTGGGAGATATCAGTGG No data
1023381681_1023381686 -4 Left 1023381681 7:39614407-39614429 CCCTCTCTAGTGTCGTGGCAGCC No data
Right 1023381686 7:39614426-39614448 AGCCATGAGGTATGAGGATTGGG No data
1023381681_1023381684 -10 Left 1023381681 7:39614407-39614429 CCCTCTCTAGTGTCGTGGCAGCC No data
Right 1023381684 7:39614420-39614442 CGTGGCAGCCATGAGGTATGAGG No data
1023381681_1023381685 -5 Left 1023381681 7:39614407-39614429 CCCTCTCTAGTGTCGTGGCAGCC No data
Right 1023381685 7:39614425-39614447 CAGCCATGAGGTATGAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023381681 Original CRISPR GGCTGCCACGACACTAGAGA GGG (reversed) Intergenic
No off target data available for this crispr