ID: 1023381685

View in Genome Browser
Species Human (GRCh38)
Location 7:39614425-39614447
Sequence CAGCCATGAGGTATGAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023381679_1023381685 10 Left 1023381679 7:39614392-39614414 CCGAAAGACATCTAGCCCTCTCT No data
Right 1023381685 7:39614425-39614447 CAGCCATGAGGTATGAGGATTGG No data
1023381682_1023381685 -6 Left 1023381682 7:39614408-39614430 CCTCTCTAGTGTCGTGGCAGCCA No data
Right 1023381685 7:39614425-39614447 CAGCCATGAGGTATGAGGATTGG No data
1023381681_1023381685 -5 Left 1023381681 7:39614407-39614429 CCCTCTCTAGTGTCGTGGCAGCC No data
Right 1023381685 7:39614425-39614447 CAGCCATGAGGTATGAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023381685 Original CRISPR CAGCCATGAGGTATGAGGAT TGG Intergenic
No off target data available for this crispr