ID: 1023382678

View in Genome Browser
Species Human (GRCh38)
Location 7:39623867-39623889
Sequence CACCCCCGCCGCCGCCCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 1, 3: 74, 4: 363}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023382678_1023382684 -9 Left 1023382678 7:39623867-39623889 CCACCCGGGCGGCGGCGGGGGTG 0: 1
1: 0
2: 1
3: 74
4: 363
Right 1023382684 7:39623881-39623903 GCGGGGGTGTGTCCGGGCGGCGG 0: 1
1: 0
2: 4
3: 42
4: 415
1023382678_1023382692 18 Left 1023382678 7:39623867-39623889 CCACCCGGGCGGCGGCGGGGGTG 0: 1
1: 0
2: 1
3: 74
4: 363
Right 1023382692 7:39623908-39623930 CCGAGGCCCTGACGCGGGTTCGG 0: 1
1: 0
2: 0
3: 4
4: 58
1023382678_1023382685 -6 Left 1023382678 7:39623867-39623889 CCACCCGGGCGGCGGCGGGGGTG 0: 1
1: 0
2: 1
3: 74
4: 363
Right 1023382685 7:39623884-39623906 GGGGTGTGTCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 44
4: 443
1023382678_1023382687 1 Left 1023382678 7:39623867-39623889 CCACCCGGGCGGCGGCGGGGGTG 0: 1
1: 0
2: 1
3: 74
4: 363
Right 1023382687 7:39623891-39623913 GTCCGGGCGGCGGCGGGCCGAGG 0: 1
1: 0
2: 5
3: 81
4: 559
1023382678_1023382689 12 Left 1023382678 7:39623867-39623889 CCACCCGGGCGGCGGCGGGGGTG 0: 1
1: 0
2: 1
3: 74
4: 363
Right 1023382689 7:39623902-39623924 GGCGGGCCGAGGCCCTGACGCGG 0: 1
1: 0
2: 3
3: 13
4: 187
1023382678_1023382693 19 Left 1023382678 7:39623867-39623889 CCACCCGGGCGGCGGCGGGGGTG 0: 1
1: 0
2: 1
3: 74
4: 363
Right 1023382693 7:39623909-39623931 CGAGGCCCTGACGCGGGTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1023382678_1023382686 -5 Left 1023382678 7:39623867-39623889 CCACCCGGGCGGCGGCGGGGGTG 0: 1
1: 0
2: 1
3: 74
4: 363
Right 1023382686 7:39623885-39623907 GGGTGTGTCCGGGCGGCGGCGGG 0: 1
1: 0
2: 4
3: 31
4: 284
1023382678_1023382690 13 Left 1023382678 7:39623867-39623889 CCACCCGGGCGGCGGCGGGGGTG 0: 1
1: 0
2: 1
3: 74
4: 363
Right 1023382690 7:39623903-39623925 GCGGGCCGAGGCCCTGACGCGGG 0: 1
1: 0
2: 1
3: 12
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023382678 Original CRISPR CACCCCCGCCGCCGCCCGGG TGG (reversed) Intronic