ID: 1023382713

View in Genome Browser
Species Human (GRCh38)
Location 7:39624000-39624022
Sequence GGCACCGCGTTCGCCGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023382703_1023382713 16 Left 1023382703 7:39623961-39623983 CCGGGGACGAGCTGCGAGATGAG 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1023382713 7:39624000-39624022 GGCACCGCGTTCGCCGCTGTGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1023382702_1023382713 17 Left 1023382702 7:39623960-39623982 CCCGGGGACGAGCTGCGAGATGA 0: 1
1: 0
2: 1
3: 3
4: 50
Right 1023382713 7:39624000-39624022 GGCACCGCGTTCGCCGCTGTGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1023382700_1023382713 28 Left 1023382700 7:39623949-39623971 CCCACGTTCTGCCCGGGGACGAG 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1023382713 7:39624000-39624022 GGCACCGCGTTCGCCGCTGTGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1023382709_1023382713 -7 Left 1023382709 7:39623984-39624006 CCCGGCTGGAATCCGGGGCACCG 0: 1
1: 0
2: 1
3: 10
4: 157
Right 1023382713 7:39624000-39624022 GGCACCGCGTTCGCCGCTGTGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1023382701_1023382713 27 Left 1023382701 7:39623950-39623972 CCACGTTCTGCCCGGGGACGAGC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1023382713 7:39624000-39624022 GGCACCGCGTTCGCCGCTGTGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1023382710_1023382713 -8 Left 1023382710 7:39623985-39624007 CCGGCTGGAATCCGGGGCACCGC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1023382713 7:39624000-39624022 GGCACCGCGTTCGCCGCTGTGGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023382713 Original CRISPR GGCACCGCGTTCGCCGCTGT GGG Intronic