ID: 1023385704

View in Genome Browser
Species Human (GRCh38)
Location 7:39655400-39655422
Sequence ATCAGTGTATGGAGGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023385704 Original CRISPR ATCAGTGTATGGAGGGGAGA TGG Intronic
902567036 1:17318459-17318481 AACAGTGTCAGGACGGGAGAAGG + Intronic
902818613 1:18930014-18930036 ACCAGTGTGTGTAGTGGAGAGGG + Intronic
904234047 1:29102332-29102354 TACTGTTTATGGAGGGGAGAAGG + Intronic
905345216 1:37306702-37306724 ATTATTGTATGCTGGGGAGAAGG - Intergenic
905597875 1:39224179-39224201 ATGTGTGTATGGGGGGGAGTAGG - Intronic
905652638 1:39666772-39666794 ATCAGGTTTGGGAGGGGAGAAGG - Intronic
905912674 1:41664578-41664600 ATCAGTCCTGGGAGGGGAGAGGG - Intronic
906123379 1:43410835-43410857 ATCAGTGTATGGCGAGGAACGGG + Intronic
906781438 1:48576326-48576348 ACCAGGGTTAGGAGGGGAGATGG - Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907488028 1:54790511-54790533 AGGACTGTCTGGAGGGGAGAAGG + Intronic
907489105 1:54797696-54797718 ATCAGTGTTTGTATGGGAGGGGG - Intronic
907710773 1:56878543-56878565 ATCAGTGGCTGGAGTGGAGCAGG - Intronic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
910292314 1:85611505-85611527 ATCAGAGTGAGGAGGGGGGAAGG + Intergenic
910317488 1:85902753-85902775 AAGGGTGTATGGATGGGAGAGGG + Intronic
910468514 1:87525755-87525777 CTCAGTGTATGTGAGGGAGAGGG + Intergenic
910904544 1:92161190-92161212 ATCAGTGTGTTCATGGGAGAAGG + Intergenic
911550383 1:99271721-99271743 ATCAGTGGGTGGGGGTGAGAGGG + Intronic
917995986 1:180438925-180438947 TTCAGAGTATGGAGGAGAGTGGG - Intronic
918596587 1:186301230-186301252 AGCAGTGTGTGAAGAGGAGAAGG + Intronic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
920256742 1:204660532-204660554 GTCTGTGTAAGGCGGGGAGAAGG - Intronic
921163796 1:212491482-212491504 ATCTGTGTATGTAGAGGGGAAGG - Intergenic
921185199 1:212664570-212664592 ATCAAGGTAGTGAGGGGAGAGGG - Intergenic
921235480 1:213123172-213123194 TTCATTTTATGGAGGGGAGGCGG + Intronic
921570455 1:216771991-216772013 ATCTGTTTATGAAGAGGAGATGG + Intronic
921587430 1:216964555-216964577 ATGAGTGTATAGAGGGGTAAGGG + Intronic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922183442 1:223254193-223254215 ATCTCTGAATGGTGGGGAGAGGG + Intronic
922361913 1:224830399-224830421 ATCAGAGCATGGACTGGAGAGGG + Intergenic
923441813 1:234027832-234027854 TTCATTCTAAGGAGGGGAGATGG + Intronic
923763805 1:236873264-236873286 ACCAGGGGATGGAGTGGAGAGGG + Intronic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1063113954 10:3060160-3060182 AGCAGGGTCTGGAGGGGAGGAGG + Intergenic
1063958284 10:11284969-11284991 ATGAGTGTGTGGATGAGAGATGG + Intronic
1064450111 10:15434522-15434544 AGCGATGTATGGAGGAGAGAAGG - Intergenic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1067936385 10:50615754-50615776 ACTAGTTTAGGGAGGGGAGAAGG - Intronic
1069064778 10:63930914-63930936 ACAAGTGTAGGGAGGGGACAGGG - Intergenic
1070150196 10:73800700-73800722 ATCAGTGTAGGGGGGGGAGCGGG - Exonic
1070592767 10:77812206-77812228 ATCAGTTACTGGAGGTGAGAGGG - Exonic
1073333668 10:102688336-102688358 ATCAGGGTATGGAAGGGTGGTGG + Intronic
1074346657 10:112692864-112692886 CTCACTGTCTGGTGGGGAGATGG - Intronic
1075883607 10:125877033-125877055 ATGAATGTATGGAGGGGGCAGGG + Intronic
1077674077 11:4182056-4182078 ATTTGTGTATGGGTGGGAGAGGG - Intergenic
1078669980 11:13355964-13355986 ATAAATGTATGGATTGGAGAAGG + Intronic
1079408776 11:20167202-20167224 GTCAGTGTAGGGAAGGGAGAGGG + Intergenic
1080008561 11:27434814-27434836 ATCAATCTAAAGAGGGGAGAGGG + Intronic
1080070314 11:28076168-28076190 GTCTGTGTTTGGAAGGGAGAGGG + Intronic
1080232507 11:30033806-30033828 ACCTGAGTATGGAGGGTAGAAGG + Intergenic
1080496016 11:32819909-32819931 ATATATGTATGGATGGGAGAAGG + Intergenic
1080652873 11:34236586-34236608 ATCAGTGGATTGAGGGGAGGGGG - Intronic
1080674105 11:34408814-34408836 AGCAGTGTATGCAGGAGATAGGG + Intergenic
1081207532 11:40293111-40293133 ACCGGAGTTTGGAGGGGAGAGGG - Exonic
1081498250 11:43638044-43638066 ATCAGTGTCTGGGAGGGGGAGGG + Intronic
1081659584 11:44879804-44879826 ATAAGTGTCTGGAGGCCAGATGG + Intronic
1081812135 11:45920119-45920141 AGCAAGGTGTGGAGGGGAGAGGG + Intergenic
1083311609 11:61786614-61786636 ATGAGTCAATGGAGGGCAGACGG + Exonic
1083599512 11:63938332-63938354 CTCAGGGTTTAGAGGGGAGACGG - Intergenic
1084021874 11:66422601-66422623 GACAGTGGATGGTGGGGAGAAGG - Intronic
1086151342 11:83614133-83614155 TTCAGTGTAGGGTGGGGAGGTGG + Intronic
1086254397 11:84857477-84857499 ATCAGTCTATGGAAAAGAGAAGG + Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087007969 11:93487434-93487456 GTGGGTGTATGGAGGGGAGGAGG + Intronic
1087332626 11:96800156-96800178 ATCAGAGGGTGGAGGGTAGAGGG - Intergenic
1087492933 11:98850580-98850602 ATTAGTGTATGAAGAGCAGAAGG + Intergenic
1087698715 11:101412015-101412037 ATCAGTTTCAGGATGGGAGAAGG - Intergenic
1087750580 11:102002676-102002698 AACAGGATATGAAGGGGAGATGG - Intergenic
1090559768 11:127919277-127919299 ATAATTGTATGGAAGGGAGTTGG + Intergenic
1090940878 11:131387363-131387385 TTCAGTGTTTGGTGGGGCGATGG - Intronic
1092959009 12:13578234-13578256 ATCAAGGTAGGGAGGGGACATGG - Intronic
1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG + Intergenic
1094472501 12:30816824-30816846 ATCTGTGTAGGGAGGGGGAAGGG + Intergenic
1095712915 12:45309139-45309161 ATTAGTGCATGAAAGGGAGAAGG + Intronic
1095882761 12:47155920-47155942 AAAAGTGAAAGGAGGGGAGAAGG + Intronic
1096483548 12:51959809-51959831 ATTTGTGAGTGGAGGGGAGAGGG + Intronic
1096884209 12:54700230-54700252 AGCAGTGGATGGAGGGAATAGGG - Intergenic
1097678902 12:62631388-62631410 ATCAGTGTTTGGTGGGTGGAAGG - Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098375634 12:69810630-69810652 GTCAGTGTATGGAGAGGAAAGGG + Intronic
1098530457 12:71535857-71535879 ATCAGTGTGTGTAGGGGGGTAGG - Intronic
1099027668 12:77486133-77486155 ATGAGTGGAAGGAGGAGAGAGGG + Intergenic
1099330603 12:81280454-81280476 ATCAGTGGCTGGAGTGAAGATGG - Intronic
1099953183 12:89326679-89326701 ACCAGTGTGTGGCAGGGAGAGGG + Intergenic
1100172436 12:91990757-91990779 AACAATGTAGGGATGGGAGAGGG + Intronic
1100722206 12:97371051-97371073 ATGAGAGGATGGAGGGGGGATGG - Intergenic
1101589485 12:106113133-106113155 CTCAGTCTTTGAAGGGGAGAGGG - Intronic
1101776127 12:107795648-107795670 ATCAGAGGTTGGAGGGAAGAGGG + Intergenic
1102322695 12:111951658-111951680 ATCAGAGAATGGAGGGTGGAAGG + Intronic
1103159344 12:118714936-118714958 AAAGGTGTATGGAAGGGAGAGGG - Intergenic
1104433331 12:128734580-128734602 ATCAGTGAGGGGAAGGGAGAAGG + Intergenic
1106086895 13:26550805-26550827 ATCAGTGTCTGGTGGGGAAGTGG + Intergenic
1109269945 13:60244160-60244182 ATCACTGTTTGGAGGAGAGTTGG + Intergenic
1109420655 13:62106725-62106747 ATCAGTGCGGGCAGGGGAGATGG + Intergenic
1111424298 13:88059113-88059135 TTCAGTGAATGAAGGGGACACGG - Intergenic
1114069540 14:19096602-19096624 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1114092722 14:19303401-19303423 GTGAGTGTGTGGGGGGGAGAGGG - Intergenic
1118095055 14:62527033-62527055 ATCAGAGGATGGAGGGTGGAAGG + Intergenic
1118451374 14:65905564-65905586 ATCAGTGTTTGGAGGAGAATAGG + Intergenic
1118469790 14:66065294-66065316 ATCAGAGTAATGAGGGGAGAAGG + Intergenic
1118872155 14:69752480-69752502 ATCTCTGTCTGGAGGGGAAAGGG + Intronic
1119055474 14:71415148-71415170 AAAGGTTTATGGAGGGGAGATGG - Intronic
1119182165 14:72612585-72612607 AACAGTGCAGGGAAGGGAGAGGG + Intergenic
1119411277 14:74432362-74432384 ACCAGGGTGTGGAGGAGAGATGG - Intergenic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1120521328 14:85530915-85530937 AACAGCTTGTGGAGGGGAGAGGG - Intronic
1121162340 14:91755435-91755457 TTCAGTGATTGCAGGGGAGATGG - Intronic
1121582443 14:95040951-95040973 AACAGTGTTTGGAAGGGGGAGGG + Intergenic
1121627177 14:95394421-95394443 ATGAGTGAATGGAGGGTTGAAGG + Intergenic
1121952227 14:98181510-98181532 CTTAGTGTATGTAAGGGAGACGG + Intergenic
1127756187 15:62094601-62094623 ATGAGAGAATGGAGGGGAGAGGG + Intergenic
1127851217 15:62913553-62913575 ATGAAGGTATGGAGGAGAGATGG + Intergenic
1129592425 15:76929119-76929141 GTCAGTCTTTTGAGGGGAGAAGG - Intergenic
1130090115 15:80814002-80814024 ATCCTTTTATGGATGGGAGAGGG - Intronic
1133416214 16:5609124-5609146 ATTATTGGAGGGAGGGGAGAGGG + Intergenic
1133565935 16:6993451-6993473 ATCAGAGTGGGAAGGGGAGATGG + Intronic
1134079542 16:11315599-11315621 ATGAGTGTATGGAGGAGATGGGG - Intronic
1135562678 16:23488509-23488531 ATCGGAGTATGGAGGGGGGCAGG - Intronic
1135660416 16:24291779-24291801 ATCCGTGTATGGCTGGGATAAGG + Intronic
1138029274 16:53547010-53547032 ATCAGTGCATGGAGGGTGGAGGG + Intergenic
1139421288 16:66850983-66851005 CTCAGTGTATGAAGAGGTGAGGG - Intronic
1139631290 16:68233491-68233513 ATGTGTCTATGGAGGGGAGTTGG - Intronic
1140601930 16:76486760-76486782 ATCACTGTATGGAGGGAAGGAGG + Intronic
1142257781 16:89023640-89023662 ATCAGTGAGGGGAGGGGAGGTGG + Intergenic
1142701106 17:1661503-1661525 ATGGTTGTATGGAGGTGAGAAGG - Intronic
1148438289 17:47698704-47698726 ATCAGTGCAGGGAGGGGCGGGGG - Exonic
1148450993 17:47777812-47777834 ATCAGAGTTTGGAAGGGAGCGGG + Intergenic
1148906403 17:50915173-50915195 ATCAGTGGATGTGGGGGAAACGG - Intergenic
1149112589 17:53050676-53050698 ATTAGAGTAGGAAGGGGAGAAGG - Intergenic
1149429702 17:56587976-56587998 GACAGTGTATGGTGGGGAGCGGG + Intergenic
1150590524 17:66558437-66558459 ATCAGTGTAGGGAGAGGAGAGGG + Intronic
1152340714 17:79722581-79722603 ACCAGTGTCTGTAGGGGAGAGGG - Intergenic
1155096488 18:22560416-22560438 ATCAGCGTTTGGAGAGTAGACGG - Intergenic
1157307554 18:46528278-46528300 TTCAGTGCATGGAGAGGAGAAGG + Intronic
1157580412 18:48770990-48771012 ATCAGCGTAGGGGGGGGAAATGG - Intronic
1158143941 18:54289347-54289369 ATAAGTGTATGGGTTGGAGAGGG + Intronic
1158167681 18:54558595-54558617 AAAAGTATATTGAGGGGAGATGG - Intergenic
1158192714 18:54848755-54848777 TTCATGGTATGGCGGGGAGAGGG + Intronic
1158876630 18:61740187-61740209 ATCAGTGGTTAGAGGGGTGAAGG + Intergenic
1159514104 18:69435277-69435299 GTCAGGATATTGAGGGGAGAAGG - Intronic
1159626775 18:70704169-70704191 TTCAGTGTCTGGAGAGGACAGGG - Intergenic
1161806176 19:6444294-6444316 TTCAGAGTCTGGAGTGGAGAAGG + Exonic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1167422739 19:49413647-49413669 ACCAGAGAAAGGAGGGGAGAAGG + Intronic
925175680 2:1782090-1782112 ATGAGTGTCTTGAAGGGAGAAGG - Intergenic
925692168 2:6536639-6536661 ACCTATGTATGGAGAGGAGATGG - Intergenic
926232933 2:11018623-11018645 GGCAGGGTATGGCGGGGAGACGG - Intergenic
927008477 2:18877424-18877446 ATCAGAGGGTGGAGGGTAGAAGG - Intergenic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928372610 2:30751999-30752021 AGCATTGTATCCAGGGGAGAGGG + Intronic
929045462 2:37784786-37784808 ATGAGTGTGGGGAGGAGAGAGGG - Intergenic
931902853 2:66808413-66808435 AACATTGCATGGATGGGAGAGGG + Intergenic
932760360 2:74435750-74435772 CACAGTGTATGGAGGAGAGCTGG - Intronic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
933790344 2:85879167-85879189 ATCAGTGCAGTGAGGGGTGACGG + Intronic
934676236 2:96251743-96251765 ATCAGTGTCAGGATGGCAGAGGG + Exonic
935542398 2:104364281-104364303 ATCAGAGACTGGAGGGTAGAAGG + Intergenic
938537198 2:132256658-132256680 AGCAGTGTGTGCAGGGAAGAGGG - Intronic
940235260 2:151504722-151504744 ATCTGCGTATGGATGGGAAAAGG + Intronic
941867239 2:170347906-170347928 GTCAGGGGCTGGAGGGGAGAAGG - Intronic
944586861 2:201180271-201180293 ATCAGGTTACAGAGGGGAGATGG - Intergenic
944783500 2:203043742-203043764 AAAAGTGTGTTGAGGGGAGAAGG + Intronic
945003999 2:205383724-205383746 ATCAGTGATTTGAGGGGTGAGGG - Intronic
945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG + Intergenic
945098205 2:206239354-206239376 ATCAGTATGTGGAGGGGAGGGGG + Intergenic
945159938 2:206879274-206879296 AACAGTGGTTGCAGGGGAGAAGG - Intergenic
946750423 2:222889849-222889871 AGCAGAGAATGGAGGTGAGAGGG + Intronic
947369648 2:229431635-229431657 ATAAGTGTGGGGAGGGGGGAGGG + Intronic
948556268 2:238813569-238813591 ATCAGAGTCTGGATGGGAGCAGG - Intergenic
948734448 2:239991783-239991805 ATCAATGTAGGGAGGTGACATGG + Intronic
1168755448 20:313836-313858 GCCAGTGTTTGGCGGGGAGAGGG - Intergenic
1168984532 20:2036746-2036768 ATGAGTGGATGGTGGGGACATGG + Intergenic
1169456762 20:5758865-5758887 AGAAGTCTGTGGAGGGGAGAGGG + Intronic
1172117387 20:32581158-32581180 AGCAGGGTATGGAGGAGAGGAGG - Intronic
1172700163 20:36848351-36848373 ATCAGTCCATCGAGGGGAGCAGG - Intronic
1173586654 20:44187517-44187539 ATCGGGGAAGGGAGGGGAGAGGG + Exonic
1173910632 20:46667195-46667217 AACAGTGTATGGAGGGACAAAGG + Intronic
1175000896 20:55629935-55629957 ATCAGTGTATAAAGGCCAGATGG - Intergenic
1175378284 20:58544469-58544491 ATCAGTGTATGCCCAGGAGAGGG + Intergenic
1175509138 20:59510377-59510399 AATAGTATATGCAGGGGAGAAGG - Intergenic
1175885159 20:62286082-62286104 ATCACTGTACGGAGAGGAGCTGG - Intronic
1176722187 21:10401957-10401979 ACCACTGTGTGGAGGGGAAATGG - Intergenic
1177473587 21:21590481-21590503 TTCAGTGTATGGTGTGAAGAAGG - Intergenic
1177979209 21:27889646-27889668 ATAAGTGTCTGCAAGGGAGAAGG - Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1179959169 21:44758705-44758727 ATCATTGTCTGGAGGGCACATGG + Intergenic
1180303374 22:11054719-11054741 ACCACTGTGTGGAGGGGAAATGG - Intergenic
1180488007 22:15819165-15819187 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1182232621 22:28850032-28850054 ATGGGTGTATGGACGGGAGGGGG - Intergenic
1183474658 22:38029483-38029505 ATCAGTGTGTGCAGGGCACAGGG + Intronic
1183693574 22:39405602-39405624 ATCAGTGTGTGCAGGGGTGGAGG + Intronic
1184211026 22:43035650-43035672 ACCACTGTGTGGAGGGGAAATGG + Intergenic
951240356 3:20279216-20279238 ATCAGTGAAAGGAGGGTAGGGGG + Intergenic
951698669 3:25472202-25472224 ATCACTGTGTGGAGAAGAGAAGG - Intronic
952719289 3:36515457-36515479 TTCAGTGTTTGAAGGGGAAAGGG + Intronic
954254665 3:49395966-49395988 TCCAGTGTATGGAATGGAGAGGG + Intronic
954527511 3:51285079-51285101 TTCAGAGTATGGAGAGGACATGG + Intronic
954903403 3:54039694-54039716 ATCAGGGTATCAAGGAGAGAAGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
960317823 3:116199809-116199831 ATAAGTTTATGAAAGGGAGAAGG + Intronic
960443842 3:117723062-117723084 AGCAGTTCATGGAGGGGAGAGGG - Intergenic
961125053 3:124409884-124409906 ATCAGTGCCTGGGGGAGAGAAGG + Intronic
961168845 3:124781458-124781480 ACCAGCACATGGAGGGGAGAGGG - Intronic
961521476 3:127469633-127469655 TTCAGTGTGTGCAGGGGGGATGG - Intergenic
962382831 3:134911168-134911190 ATCAGTGGATGCAGTGGACAGGG + Intronic
964496064 3:157291562-157291584 ATCAGTCCAAGGAGGTGAGAAGG + Intronic
964849735 3:161082115-161082137 CTCAGTGTCTGAAAGGGAGAGGG - Intergenic
964893851 3:161570149-161570171 ATCAGTGTAAGGTGGGGAGGGGG - Intergenic
965417508 3:168415224-168415246 ATCAGAGTATAAATGGGAGAAGG - Intergenic
965834815 3:172839544-172839566 ATCATTGTATGGAGGAGTGTTGG + Intergenic
967057909 3:185846159-185846181 AGCAGTGTGTGGTGGGGGGAGGG + Intergenic
967453742 3:189656423-189656445 ATAAGGGTATGTATGGGAGATGG + Intronic
967787188 3:193510000-193510022 ATGCATGAATGGAGGGGAGAAGG + Intronic
968940707 4:3636115-3636137 ATCAGGCTAGGAAGGGGAGATGG - Intergenic
968940721 4:3636185-3636207 ATCAGGCTAGGAAGGGGAGATGG - Intergenic
968951440 4:3696360-3696382 AGCAGAGTATGGAAGGGGGAGGG - Intergenic
969464628 4:7349007-7349029 ATAAGTGTATGGAAGCCAGAGGG - Intronic
969510551 4:7615130-7615152 ATGAGTGAATGGATGGCAGATGG - Intronic
969621955 4:8283112-8283134 ATCAGTGCATGGATGAGTGAGGG + Intronic
971395718 4:26225431-26225453 ATCAGTGTTTGCCGGGGAAAGGG + Intronic
973938649 4:55879537-55879559 TGCAGGGTAGGGAGGGGAGATGG + Intronic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
977882834 4:102225505-102225527 AACAGTGTATTGAAGGGAAAAGG - Intergenic
980538901 4:134166830-134166852 GTCAGTGAATGAAGGGCAGAGGG - Intergenic
981061800 4:140432569-140432591 ATCAGATTTTGGAGGGGACAGGG + Intergenic
982833099 4:160087626-160087648 ATAACTGTATGGAGGTGATATGG - Intergenic
984117402 4:175698877-175698899 GGCAGTGTATGTAGGGGTGAGGG - Intronic
985255178 4:188063031-188063053 TTCAGTCTGAGGAGGGGAGATGG + Intergenic
986341233 5:6791106-6791128 ATCAGAGCAGGGAGAGGAGATGG - Intergenic
986580810 5:9263930-9263952 ATCAATTTCTGCAGGGGAGATGG - Intronic
988489806 5:31696789-31696811 GTCAGTGCTTGTAGGGGAGAAGG - Intronic
989178525 5:38554314-38554336 AACAGTGTATGCTGGGGAGAAGG + Intronic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
992135022 5:73735938-73735960 GTCTCTGTATGGATGGGAGAGGG - Intronic
992502462 5:77356153-77356175 AGAAGTGTATGAAGGGGAGAAGG - Intronic
993861868 5:93145987-93146009 CTGAGTGTATGCAGGGGAGCTGG - Intergenic
994641356 5:102413456-102413478 ATCAGTGTATGCTAGGGAGTGGG - Intronic
999369666 5:151046187-151046209 ATGACCGTAGGGAGGGGAGAAGG - Intronic
1002165091 5:177338940-177338962 AGCAGTGGATGGAGAGGAAATGG - Intronic
1005959106 6:30683836-30683858 ATCCTAGGATGGAGGGGAGAGGG - Intronic
1007211338 6:40195487-40195509 AACAGTGGAGGGAGGGGAGATGG - Intergenic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007959693 6:45947471-45947493 GGCAGTGGATGGAGGGGTGAGGG - Intronic
1007987279 6:46219281-46219303 AGCAGTTTATGGATGGGAGGTGG + Intergenic
1008160185 6:48067737-48067759 ATCAGTGAATGGAAGGGGGAGGG - Intronic
1008525969 6:52407250-52407272 TGCAGTGTAGGGAGAGGAGATGG + Exonic
1009330109 6:62408699-62408721 TTCAGAGGATGGAGGGGAGGAGG + Intergenic
1009430349 6:63559021-63559043 TTGACTGTATGGAGGCGAGAAGG + Intronic
1012814006 6:103999094-103999116 ATCAGAGGGTGGAGGGCAGAAGG - Intergenic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1014184005 6:118414797-118414819 ATCAGAGAATGGAGGGTAGGAGG + Intergenic
1015156500 6:130102188-130102210 ACCTGTGGATGGATGGGAGATGG - Intronic
1018146305 6:160892991-160893013 ATCAGTGGATTGAGGAGTGAGGG - Intergenic
1018373215 6:163187239-163187261 ATCAGTCTATGGAGGGATGTTGG - Intronic
1018501277 6:164413303-164413325 TTCAGTGGAGGGAGGGGAGGAGG - Intergenic
1018861017 6:167710649-167710671 ATCCGTGTGTGAAAGGGAGAAGG - Intergenic
1018871929 6:167790267-167790289 ATGGGTGGATGGTGGGGAGATGG - Intronic
1018874104 6:167804664-167804686 ATCAGTCAAAGGAGGGCAGAAGG + Intergenic
1019103323 6:169649712-169649734 ATGAGTGAATGGATGGGTGATGG - Intronic
1019537445 7:1536732-1536754 TTCTGTGCATGGTGGGGAGAGGG + Intronic
1021274927 7:18638600-18638622 ATCAGTGTTTGGAAGGCAGGTGG + Intronic
1021736781 7:23647329-23647351 AGGAATCTATGGAGGGGAGAGGG + Intergenic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1023519243 7:41034253-41034275 ATGAGTGTGTGCAAGGGAGAAGG + Intergenic
1024992020 7:55242320-55242342 ACCATTGTATGGAGGGCTGATGG + Intronic
1026026523 7:66749099-66749121 ATCTCTGTATGGAGGTGAGGTGG - Intronic
1027421535 7:78021680-78021702 ATCAGTGTATGGAAGAAGGAAGG - Intronic
1028163081 7:87507978-87508000 ATTAGTGTAGGGAGGGAAGGGGG + Intronic
1028385013 7:90244958-90244980 ATGAGTGGGTGGAGGGGTGAGGG - Intergenic
1028464017 7:91128883-91128905 ATTAGTTAATGGAGAGGAGATGG - Intronic
1030680384 7:112427866-112427888 ATCACAGTCTGGAGAGGAGAGGG + Intronic
1031199885 7:118668713-118668735 ATCAGTGGACTGAGTGGAGAAGG + Intergenic
1032549065 7:132767388-132767410 ATCAGTGTCTGGAGGTTAGTTGG - Intergenic
1032823839 7:135550373-135550395 AGCAGTGTGTGGAGGAGAGTGGG - Intergenic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1035866128 8:3084073-3084095 ATCTGTGAGTGGATGGGAGAAGG + Intronic
1036149744 8:6286362-6286384 ATCAGTAGATGGAGTGAAGAAGG - Intergenic
1037611785 8:20481975-20481997 CTCAGTGTGTGCAGGGGATATGG - Intergenic
1038384752 8:27132529-27132551 ATCAGTGTTTGCAGGGGAATGGG - Intergenic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039674155 8:39641484-39641506 ATCAGAGGATGGAGGGTAGGAGG - Intronic
1041870902 8:62633544-62633566 ATCAGTGGCTGCAGGAGAGAGGG + Intronic
1045654968 8:104377201-104377223 AACAGTGGGGGGAGGGGAGAGGG + Intronic
1045921534 8:107535833-107535855 ATCCTTATACGGAGGGGAGAGGG + Intergenic
1046059680 8:109122922-109122944 ATGAGAGTTTGGTGGGGAGAGGG - Intergenic
1046360494 8:113147660-113147682 GTAGGTGTGTGGAGGGGAGAGGG + Intronic
1047508097 8:125495748-125495770 CTCAGTTTATGAAGTGGAGAGGG + Intergenic
1049478847 8:142810487-142810509 ATGAGTGGTTGGAGGGGTGAAGG - Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052635025 9:31092239-31092261 TTCAGAGAATGGAGGGTAGAAGG - Intergenic
1052882526 9:33612305-33612327 ATCAGTGATTAGAGGGGATACGG - Intergenic
1055502588 9:76916392-76916414 ATGAGTGTCTTCAGGGGAGAAGG - Intergenic
1056053877 9:82800318-82800340 AGTAGTGTGTGGAGGGGTGAGGG - Intergenic
1056099792 9:83290488-83290510 ATTAGTGTATGGGGTGGAGTGGG - Intronic
1056517737 9:87371270-87371292 ATCAGTTATTGGAGGAGAGAAGG + Intergenic
1057568703 9:96187041-96187063 AAGAGAGGATGGAGGGGAGAGGG - Intergenic
1058633106 9:107009445-107009467 ATCAGTGAAGGTAGGAGAGAGGG + Intronic
1059710075 9:116859693-116859715 ATGAGTGTATGAAGGGGATGAGG + Intronic
1061507738 9:131041040-131041062 ATAAGTGGATGGAGGAGTGAGGG + Intronic
1061565611 9:131437675-131437697 TTCAGTGTTAGGTGGGGAGAGGG - Intronic
1061677223 9:132224469-132224491 ATCAGTGATTGGAGGGGACAGGG - Intronic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1186052108 X:5607819-5607841 ATAAGTTCATGGAGGGGAAATGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1188817735 X:34736169-34736191 ATCAGAGGATGGAGGGTAGGAGG - Intergenic
1189039240 X:37524899-37524921 ATTAGTCTATGGAGAGGATAAGG + Intronic
1189760923 X:44320789-44320811 AGGAGTGAATGGAGGGGAGAAGG - Intronic
1189846456 X:45143095-45143117 ATCAGTGTATGAAGTGGAAGAGG - Intergenic
1191060210 X:56287252-56287274 ATCATTTTTTGTAGGGGAGAGGG - Intronic
1193797677 X:85896475-85896497 AGCAGTTTGTGGAGGGAAGATGG + Intronic
1193815217 X:86096905-86096927 ATCAGTGTATGGAGGAGCTGAGG - Intergenic
1194461504 X:94175370-94175392 ATAAGTTTATGGAGGGTATAAGG + Intergenic
1194710662 X:97232641-97232663 ATCAGGGTGTGGACGGCAGAAGG - Intronic
1194926595 X:99832929-99832951 ATCAGAGTATGGAGGATGGAAGG + Intergenic
1194956725 X:100189662-100189684 ATCAGAGTGTGGAGGGAAGAAGG + Intergenic
1196899938 X:120372825-120372847 ACCAGTGAAACGAGGGGAGACGG + Intronic
1198074123 X:133178583-133178605 ATCAGTGTGTGGATTTGAGAAGG - Intergenic
1199190725 X:144966729-144966751 ATCAGTATATGAAGGAGATATGG + Intergenic
1199975222 X:152891102-152891124 AAGAGTCTATGAAGGGGAGAAGG + Intergenic