ID: 1023388952 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:39688901-39688923 |
| Sequence | CAATTGTGGCAGAGGGTGAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 5051 | |||
| Summary | {0: 1, 1: 25, 2: 200, 3: 1678, 4: 3147} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1023388943_1023388952 | 23 | Left | 1023388943 | 7:39688855-39688877 | CCACAGGCTTAACAGGAAGCATG | 0: 134 1: 173 2: 853 3: 1207 4: 1081 |
||
| Right | 1023388952 | 7:39688901-39688923 | CAATTGTGGCAGAGGGTGAAGGG | 0: 1 1: 25 2: 200 3: 1678 4: 3147 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1023388952 | Original CRISPR | CAATTGTGGCAGAGGGTGAA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||