ID: 1023388952

View in Genome Browser
Species Human (GRCh38)
Location 7:39688901-39688923
Sequence CAATTGTGGCAGAGGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5051
Summary {0: 1, 1: 25, 2: 200, 3: 1678, 4: 3147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023388943_1023388952 23 Left 1023388943 7:39688855-39688877 CCACAGGCTTAACAGGAAGCATG 0: 134
1: 173
2: 853
3: 1207
4: 1081
Right 1023388952 7:39688901-39688923 CAATTGTGGCAGAGGGTGAAGGG 0: 1
1: 25
2: 200
3: 1678
4: 3147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023388952 Original CRISPR CAATTGTGGCAGAGGGTGAA GGG Intronic
Too many off-targets to display for this crispr