ID: 1023389269

View in Genome Browser
Species Human (GRCh38)
Location 7:39692728-39692750
Sequence CTACTAAGCTACTCTGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023389269_1023389271 30 Left 1023389269 7:39692728-39692750 CCTGACTCAGAGTAGCTTAGTAG 0: 1
1: 0
2: 0
3: 12
4: 68
Right 1023389271 7:39692781-39692803 ATATACACACATATGACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023389269 Original CRISPR CTACTAAGCTACTCTGAGTC AGG (reversed) Intronic
903341559 1:22658170-22658192 CAACTAAGCTACTATGAGTTTGG - Intronic
904316108 1:29664839-29664861 CTCCTAATCTGCTCTGAGACAGG + Intergenic
922043821 1:221924108-221924130 TTATTGAGCTGCTCTGAGTCAGG + Intergenic
1062936746 10:1395904-1395926 CTACTGAGCTTCTTTGAATCTGG + Intronic
1065045887 10:21747445-21747467 CTCCTTAGGAACTCTGAGTCGGG - Intergenic
1068343200 10:55736063-55736085 CTACTAAGCTCCTCATACTCAGG + Intergenic
1069863286 10:71484442-71484464 CTGCCCAGCTCCTCTGAGTCTGG - Intronic
1071343720 10:84671613-84671635 ATTCTGAGCTACTCTGAGTCAGG + Intergenic
1071588890 10:86852653-86852675 CTAATAAGCTAATCTAAGTTAGG + Intronic
1073631020 10:105149158-105149180 CTACAAAGATACTATGAGACTGG - Intronic
1076685995 10:132198733-132198755 CTACTAGGCTGCCCTGAGCCTGG + Intronic
1085603048 11:77872604-77872626 CTACTAACCAACCCTGAGACTGG + Intronic
1086204017 11:84236763-84236785 CTGCTAACCTACTATGATTCTGG - Intronic
1088848031 11:113683852-113683874 CTACTAAACTAATCAGAGCCAGG - Intergenic
1089905954 11:122038835-122038857 TGGCTAAGCTACTCTGAGTTGGG + Intergenic
1095235965 12:39796066-39796088 CTACTAATCTACTCTGTGTATGG + Intronic
1096626057 12:52896774-52896796 CTACTTGGCTTCTCTGAGCCTGG + Intergenic
1106236456 13:27865235-27865257 CTACTATGCTACTCTGTCTCCGG - Intergenic
1109804775 13:67424666-67424688 ATACTAAGCTATACTGAGTTTGG + Intergenic
1110021056 13:70473562-70473584 TTGCTAAGCTACTCTGTTTCAGG - Intergenic
1113835813 13:113327898-113327920 GTTCTAAGCTTCTCTGTGTCTGG - Intronic
1114177530 14:20336416-20336438 CTACTAAGGTAGGCTGAGTCGGG + Intergenic
1114254680 14:20991358-20991380 CTACTGAACTACTGTGAGCCAGG - Intronic
1115325099 14:32129098-32129120 CTTCTAATCTGCTGTGAGTCAGG + Intronic
1120221485 14:81739210-81739232 CTACTTAGCAACTCTGATTCTGG - Intergenic
1127302091 15:57664769-57664791 GTACTCAGGTAGTCTGAGTCTGG - Intronic
1129232632 15:74205261-74205283 CTTCTAAGTTACCCAGAGTCAGG - Intronic
1130934298 15:88455595-88455617 CTACTAAGCCACTCTGAAGTGGG - Intergenic
1138825546 16:60314941-60314963 CTATTAACCTATTCTGAGTGTGG - Intergenic
1138828481 16:60350841-60350863 CTTCTAACCTTCTCTGAATCTGG - Intergenic
1145055391 17:19700392-19700414 CTACCAAGAAACTCCGAGTCAGG - Intronic
1151071865 17:71223291-71223313 CTTTTAAGATACTCTGAGTATGG - Intergenic
1152650927 17:81492395-81492417 CCACTGAGCCACTCTGAGTGCGG + Intergenic
1156027047 18:32667154-32667176 ATTCTCAGCTACTCTGAGGCAGG - Intergenic
1160146913 18:76372625-76372647 CTATTGAGCTACTCTGAATTAGG - Intronic
1162985506 19:14266888-14266910 CTTCTCAGCTGCTCTGGGTCAGG + Intergenic
1164148525 19:22528706-22528728 CTATGAACCTCCTCTGAGTCAGG + Intronic
1164464568 19:28476496-28476518 CTGCTTAGCTACTCAGTGTCTGG - Intergenic
928286291 2:29992738-29992760 CTTCAAAGCTAGTCTGCGTCAGG - Intergenic
942423363 2:175832532-175832554 CTACAAACCTAGTCTGAGTCTGG + Intergenic
943481395 2:188423193-188423215 TTACTAAGCTATTTTGAGTGTGG - Intronic
946349967 2:219143903-219143925 CTAATAAGCAACACTGAGCCAGG + Intronic
947691934 2:232146400-232146422 TTATTAAGTCACTCTGAGTCAGG - Intronic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1171523080 20:25790253-25790275 ATAATAAGCTACACTGAGGCCGG - Intronic
1171553747 20:26065630-26065652 ATAATAAGCTACACTGAGGCCGG + Intergenic
1175630252 20:60529495-60529517 CAACAAAGCTACTCTGTGCCTGG + Intergenic
1182923516 22:34101950-34101972 CTACTAAGTGACTCTGGGGCTGG + Intergenic
955434149 3:58883235-58883257 TTTCAAAGCTACTGTGAGTCTGG + Intronic
955956691 3:64297210-64297232 CTCCTGAGCTGCTCTGATTCAGG - Intronic
956634325 3:71348388-71348410 CTTCTAAGCTGCTCTTAGCCTGG - Intronic
956968479 3:74492013-74492035 CTACAAGGCTACTCTGCTTCTGG - Intronic
957358734 3:79126407-79126429 CTCCTCTGCTACTCTGAGTCTGG - Intronic
957570837 3:81945999-81946021 CTACTATGCGACTATGAATCTGG - Intergenic
969920001 4:10529425-10529447 CTATGAAGCAACTATGAGTCAGG - Intronic
970248423 4:14088941-14088963 CTACTGAATTACTCTGAGACTGG + Intergenic
972875811 4:43358431-43358453 CTACTAAGCTCATTTGAGGCAGG - Intergenic
973316647 4:48767616-48767638 CTACTCTGTTACTCTGAGTTTGG - Intronic
973588542 4:52416685-52416707 CTACTAAGCTACCATCAGTGGGG + Intergenic
975523025 4:75320460-75320482 CTACTCAGTTGCTCTGAGTCAGG + Intergenic
982899805 4:160983565-160983587 CTCCTAACTTACTCTGACTCAGG - Intergenic
990630326 5:57661801-57661823 CTTCTATGTTACTCTGAGTCAGG + Intergenic
996780509 5:127181696-127181718 CCACTAAGCTTCTCTGACTCTGG - Intergenic
999317616 5:150594375-150594397 CCTCTGAGCTACTCAGAGTCTGG - Intergenic
1010616006 6:78013170-78013192 CTACTTAGCTGATCTGAGTTTGG - Intergenic
1010867163 6:80991313-80991335 CTACTAAGCTACACAGCCTCAGG + Intergenic
1013614090 6:111825451-111825473 TTACTAAGCTTCTCTGACTGTGG + Intronic
1018329189 6:162709503-162709525 CAACTAAGGAACTCTGAGTTTGG - Intronic
1018436706 6:163766291-163766313 CTTCTAAGCTACTCTGAAATAGG + Intergenic
1023389269 7:39692728-39692750 CTACTAAGCTACTCTGAGTCAGG - Intronic
1024167872 7:46752537-46752559 CTTCCAAGAGACTCTGAGTCAGG - Intronic
1029349709 7:100004478-100004500 CCACTTAGCTACTCTGAGGACGG - Intergenic
1043148075 8:76681098-76681120 CTCCGGAGCTGCTCTGAGTCCGG + Intergenic
1056879987 9:90381674-90381696 CTACTAAGCTAGGCTGACACAGG + Intergenic
1059313953 9:113408626-113408648 CTACTCAGATGCTCTGAGTTTGG + Exonic
1186264961 X:7822592-7822614 CTTTTGAGCTACTCTGTGTCAGG - Intergenic
1187622740 X:21076555-21076577 CCACTAATCTACTTTCAGTCTGG + Intergenic
1190539577 X:51463341-51463363 CTACTAAGCTATGCTGACCCAGG - Intergenic
1197869323 X:131050561-131050583 CTTCTGAGCTACTTTGGGTCTGG - Intergenic
1199096932 X:143754459-143754481 CAACTAAGCTACATTGTGTCTGG + Intergenic
1201666165 Y:16458439-16458461 CTACTAAACTACACTGACTCAGG - Intergenic