ID: 1023391385

View in Genome Browser
Species Human (GRCh38)
Location 7:39714721-39714743
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023391385_1023391388 -2 Left 1023391385 7:39714721-39714743 CCAGGGCACAAAGGGGCCCAGGT No data
Right 1023391388 7:39714742-39714764 GTACAGCTTGAGCTGCCACTTGG No data
1023391385_1023391389 -1 Left 1023391385 7:39714721-39714743 CCAGGGCACAAAGGGGCCCAGGT No data
Right 1023391389 7:39714743-39714765 TACAGCTTGAGCTGCCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023391385 Original CRISPR ACCTGGGCCCCTTTGTGCCC TGG (reversed) Intergenic
No off target data available for this crispr