ID: 1023391902

View in Genome Browser
Species Human (GRCh38)
Location 7:39718867-39718889
Sequence TATCCAACTCCCAGGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023391902_1023391906 -4 Left 1023391902 7:39718867-39718889 CCCAACTCCCTGGGAGTTGGATA No data
Right 1023391906 7:39718886-39718908 GATACATCTTTAAATTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023391902 Original CRISPR TATCCAACTCCCAGGGAGTT GGG (reversed) Intergenic
No off target data available for this crispr