ID: 1023393398

View in Genome Browser
Species Human (GRCh38)
Location 7:39731568-39731590
Sequence CAGATCATGAAGGACTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023393394_1023393398 12 Left 1023393394 7:39731533-39731555 CCACACTCAGCACAGGGTGTAAG No data
Right 1023393398 7:39731568-39731590 CAGATCATGAAGGACTTGAATGG No data
1023393391_1023393398 26 Left 1023393391 7:39731519-39731541 CCATGACGCTATTACCACACTCA No data
Right 1023393398 7:39731568-39731590 CAGATCATGAAGGACTTGAATGG No data
1023393390_1023393398 27 Left 1023393390 7:39731518-39731540 CCCATGACGCTATTACCACACTC No data
Right 1023393398 7:39731568-39731590 CAGATCATGAAGGACTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023393398 Original CRISPR CAGATCATGAAGGACTTGAA TGG Intergenic
No off target data available for this crispr