ID: 1023393608

View in Genome Browser
Species Human (GRCh38)
Location 7:39732892-39732914
Sequence CAGTGTGCATGGCGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023393608_1023393615 2 Left 1023393608 7:39732892-39732914 CCTCCTTCCCGCCATGCACACTG No data
Right 1023393615 7:39732917-39732939 ACTAGTGGAGCAGTTTTCCAGGG No data
1023393608_1023393616 5 Left 1023393608 7:39732892-39732914 CCTCCTTCCCGCCATGCACACTG No data
Right 1023393616 7:39732920-39732942 AGTGGAGCAGTTTTCCAGGGTGG No data
1023393608_1023393614 1 Left 1023393608 7:39732892-39732914 CCTCCTTCCCGCCATGCACACTG No data
Right 1023393614 7:39732916-39732938 AACTAGTGGAGCAGTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023393608 Original CRISPR CAGTGTGCATGGCGGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr