ID: 1023395240

View in Genome Browser
Species Human (GRCh38)
Location 7:39745755-39745777
Sequence TCCAGGGCCCCTGGTCAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023395240_1023395247 -3 Left 1023395240 7:39745755-39745777 CCTCGTTGACCAGGGGCCCTGGA No data
Right 1023395247 7:39745775-39745797 GGAGATGCTGCCTGGGGCTAAGG No data
1023395240_1023395244 -9 Left 1023395240 7:39745755-39745777 CCTCGTTGACCAGGGGCCCTGGA No data
Right 1023395244 7:39745769-39745791 GGCCCTGGAGATGCTGCCTGGGG No data
1023395240_1023395248 2 Left 1023395240 7:39745755-39745777 CCTCGTTGACCAGGGGCCCTGGA No data
Right 1023395248 7:39745780-39745802 TGCTGCCTGGGGCTAAGGCAAGG No data
1023395240_1023395243 -10 Left 1023395240 7:39745755-39745777 CCTCGTTGACCAGGGGCCCTGGA No data
Right 1023395243 7:39745768-39745790 GGGCCCTGGAGATGCTGCCTGGG No data
1023395240_1023395249 3 Left 1023395240 7:39745755-39745777 CCTCGTTGACCAGGGGCCCTGGA No data
Right 1023395249 7:39745781-39745803 GCTGCCTGGGGCTAAGGCAAGGG No data
1023395240_1023395251 9 Left 1023395240 7:39745755-39745777 CCTCGTTGACCAGGGGCCCTGGA No data
Right 1023395251 7:39745787-39745809 TGGGGCTAAGGCAAGGGCACTGG No data
1023395240_1023395252 24 Left 1023395240 7:39745755-39745777 CCTCGTTGACCAGGGGCCCTGGA No data
Right 1023395252 7:39745802-39745824 GGCACTGGATTTGAAAGCTGAGG No data
1023395240_1023395253 25 Left 1023395240 7:39745755-39745777 CCTCGTTGACCAGGGGCCCTGGA No data
Right 1023395253 7:39745803-39745825 GCACTGGATTTGAAAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023395240 Original CRISPR TCCAGGGCCCCTGGTCAACG AGG (reversed) Intergenic
No off target data available for this crispr