ID: 1023396236

View in Genome Browser
Species Human (GRCh38)
Location 7:39754267-39754289
Sequence TCTAGCTGGCCTGCAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023396230_1023396236 -5 Left 1023396230 7:39754249-39754271 CCCACGCCCACCTGGAACTCTAG No data
Right 1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG No data
1023396231_1023396236 -6 Left 1023396231 7:39754250-39754272 CCACGCCCACCTGGAACTCTAGC No data
Right 1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG No data
1023396218_1023396236 29 Left 1023396218 7:39754215-39754237 CCGGCCCGCCGCTCCGAGTGCGG No data
Right 1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG No data
1023396227_1023396236 3 Left 1023396227 7:39754241-39754263 CCGCCAAGCCCACGCCCACCTGG 0: 57
1: 524
2: 520
3: 379
4: 680
Right 1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG No data
1023396225_1023396236 16 Left 1023396225 7:39754228-39754250 CCGAGTGCGGGGCCCGCCAAGCC 0: 237
1: 383
2: 328
3: 217
4: 228
Right 1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG No data
1023396222_1023396236 25 Left 1023396222 7:39754219-39754241 CCCGCCGCTCCGAGTGCGGGGCC 0: 44
1: 353
2: 475
3: 417
4: 316
Right 1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG No data
1023396226_1023396236 4 Left 1023396226 7:39754240-39754262 CCCGCCAAGCCCACGCCCACCTG 0: 44
1: 451
2: 515
3: 433
4: 647
Right 1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG No data
1023396224_1023396236 21 Left 1023396224 7:39754223-39754245 CCGCTCCGAGTGCGGGGCCCGCC 0: 46
1: 135
2: 165
3: 213
4: 255
Right 1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG No data
1023396229_1023396236 0 Left 1023396229 7:39754244-39754266 CCAAGCCCACGCCCACCTGGAAC 0: 92
1: 754
2: 595
3: 338
4: 386
Right 1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG No data
1023396223_1023396236 24 Left 1023396223 7:39754220-39754242 CCGCCGCTCCGAGTGCGGGGCCC No data
Right 1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023396236 Original CRISPR TCTAGCTGGCCTGCAAGCCC CGG Intergenic
No off target data available for this crispr