ID: 1023400180

View in Genome Browser
Species Human (GRCh38)
Location 7:39787009-39787031
Sequence TCTCAACACCACCATGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023400180_1023400197 29 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400197 7:39787061-39787083 GGCCAGGGAGTTACTGGGTGGGG No data
1023400180_1023400195 27 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400195 7:39787059-39787081 GAGGCCAGGGAGTTACTGGGTGG No data
1023400180_1023400190 8 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400190 7:39787040-39787062 GAGGGGAGAAGTAGGGGAGGAGG No data
1023400180_1023400189 5 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400189 7:39787037-39787059 TCAGAGGGGAGAAGTAGGGGAGG No data
1023400180_1023400196 28 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400196 7:39787060-39787082 AGGCCAGGGAGTTACTGGGTGGG No data
1023400180_1023400193 23 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400193 7:39787055-39787077 GGAGGAGGCCAGGGAGTTACTGG No data
1023400180_1023400184 -10 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400184 7:39787022-39787044 GGTGTTGAGAGATGGTCAGAGGG No data
1023400180_1023400191 13 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400191 7:39787045-39787067 GAGAAGTAGGGGAGGAGGCCAGG 0: 13
1: 15
2: 16
3: 96
4: 958
1023400180_1023400185 -9 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400185 7:39787023-39787045 GTGTTGAGAGATGGTCAGAGGGG No data
1023400180_1023400192 14 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400192 7:39787046-39787068 AGAAGTAGGGGAGGAGGCCAGGG 0: 13
1: 15
2: 15
3: 78
4: 777
1023400180_1023400186 0 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400186 7:39787032-39787054 GATGGTCAGAGGGGAGAAGTAGG No data
1023400180_1023400194 24 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400194 7:39787056-39787078 GAGGAGGCCAGGGAGTTACTGGG No data
1023400180_1023400188 2 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400188 7:39787034-39787056 TGGTCAGAGGGGAGAAGTAGGGG No data
1023400180_1023400187 1 Left 1023400180 7:39787009-39787031 CCAGGGCCATGGTGGTGTTGAGA No data
Right 1023400187 7:39787033-39787055 ATGGTCAGAGGGGAGAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023400180 Original CRISPR TCTCAACACCACCATGGCCC TGG (reversed) Intergenic
No off target data available for this crispr