ID: 1023401655

View in Genome Browser
Species Human (GRCh38)
Location 7:39795925-39795947
Sequence ACTGCAGGTGAAACAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023401655_1023401662 26 Left 1023401655 7:39795925-39795947 CCAGCATCTGTTTCACCTGCAGT No data
Right 1023401662 7:39795974-39795996 TCATGCAGTCATCAGTCCCACGG No data
1023401655_1023401658 -8 Left 1023401655 7:39795925-39795947 CCAGCATCTGTTTCACCTGCAGT No data
Right 1023401658 7:39795940-39795962 CCTGCAGTGGAAGATCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023401655 Original CRISPR ACTGCAGGTGAAACAGATGC TGG (reversed) Intergenic
No off target data available for this crispr