ID: 1023405008

View in Genome Browser
Species Human (GRCh38)
Location 7:39824351-39824373
Sequence TAGTCTTATTTTCAACTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023405008_1023405011 -2 Left 1023405008 7:39824351-39824373 CCTTGCAGTTGAAAATAAGACTA No data
Right 1023405011 7:39824372-39824394 TAGGCAGTGAATACTACAGGTGG No data
1023405008_1023405010 -5 Left 1023405008 7:39824351-39824373 CCTTGCAGTTGAAAATAAGACTA No data
Right 1023405010 7:39824369-39824391 GACTAGGCAGTGAATACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023405008 Original CRISPR TAGTCTTATTTTCAACTGCA AGG (reversed) Intergenic
No off target data available for this crispr