ID: 1023406614

View in Genome Browser
Species Human (GRCh38)
Location 7:39840456-39840478
Sequence CAGACACAAAATCAATCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023406614_1023406617 23 Left 1023406614 7:39840456-39840478 CCTGTGGATTGATTTTGTGTCTG No data
Right 1023406617 7:39840502-39840524 CTGCTCACACTGATGCTGGTTGG No data
1023406614_1023406616 19 Left 1023406614 7:39840456-39840478 CCTGTGGATTGATTTTGTGTCTG No data
Right 1023406616 7:39840498-39840520 CAAGCTGCTCACACTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023406614 Original CRISPR CAGACACAAAATCAATCCAC AGG (reversed) Intergenic
No off target data available for this crispr