ID: 1023406617

View in Genome Browser
Species Human (GRCh38)
Location 7:39840502-39840524
Sequence CTGCTCACACTGATGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023406613_1023406617 28 Left 1023406613 7:39840451-39840473 CCTAGCCTGTGGATTGATTTTGT No data
Right 1023406617 7:39840502-39840524 CTGCTCACACTGATGCTGGTTGG No data
1023406614_1023406617 23 Left 1023406614 7:39840456-39840478 CCTGTGGATTGATTTTGTGTCTG No data
Right 1023406617 7:39840502-39840524 CTGCTCACACTGATGCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023406617 Original CRISPR CTGCTCACACTGATGCTGGT TGG Intergenic
No off target data available for this crispr