ID: 1023412286

View in Genome Browser
Species Human (GRCh38)
Location 7:39900167-39900189
Sequence GTTTTCTTGTGAACAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023412286_1023412291 20 Left 1023412286 7:39900167-39900189 CCAGATTTTGTTCACAAGAAAAC No data
Right 1023412291 7:39900210-39900232 ATACCCCTACTTGTAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023412286 Original CRISPR GTTTTCTTGTGAACAAAATC TGG (reversed) Intergenic
No off target data available for this crispr