ID: 1023412644

View in Genome Browser
Species Human (GRCh38)
Location 7:39903019-39903041
Sequence CTGTATACCGGTTTCTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023412644_1023412650 4 Left 1023412644 7:39903019-39903041 CCAAAGCAGAAACCGGTATACAG No data
Right 1023412650 7:39903046-39903068 CTCCATGGGAACCAGTGCCAGGG No data
1023412644_1023412647 -10 Left 1023412644 7:39903019-39903041 CCAAAGCAGAAACCGGTATACAG No data
Right 1023412647 7:39903032-39903054 CGGTATACAGATTCCTCCATGGG No data
1023412644_1023412649 3 Left 1023412644 7:39903019-39903041 CCAAAGCAGAAACCGGTATACAG No data
Right 1023412649 7:39903045-39903067 CCTCCATGGGAACCAGTGCCAGG No data
1023412644_1023412652 8 Left 1023412644 7:39903019-39903041 CCAAAGCAGAAACCGGTATACAG No data
Right 1023412652 7:39903050-39903072 ATGGGAACCAGTGCCAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023412644 Original CRISPR CTGTATACCGGTTTCTGCTT TGG (reversed) Intergenic
No off target data available for this crispr